Incidental Mutation 'R1229:Tram1'
ID172424
Institutional Source Beutler Lab
Gene Symbol Tram1
Ensembl Gene ENSMUSG00000025935
Gene Nametranslocating chain-associating membrane protein 1
SynonymsTRAMP, 1810049E02Rik
MMRRC Submission 039298-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.602) question?
Stock #R1229 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location13564698-13589910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13569552 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 324 (R324G)
Ref Sequence ENSEMBL: ENSMUSP00000027068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027068]
Predicted Effect probably damaging
Transcript: ENSMUST00000027068
AA Change: R324G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027068
Gene: ENSMUSG00000025935
AA Change: R324G

DomainStartEndE-ValueType
Pfam:TRAM1 47 115 6.1e-24 PFAM
TLC 117 326 2.36e-54 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a multi-pass transmembrane protein of the endoplasmic reticulum (ER). It is involved in the process of cotranslational translocation of secretory proteins into the ER. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid1a A C 4: 133,691,237 L1012V unknown Het
Bzw1 A G 1: 58,394,219 N35S probably benign Het
Ccdc93 A G 1: 121,434,642 D51G probably damaging Het
Dnah1 A T 14: 31,310,851 M409K probably benign Het
Fam13b C T 18: 34,445,583 M705I probably benign Het
Gm1110 T C 9: 26,881,806 Y558C probably benign Het
Iqgap2 A G 13: 95,632,165 I1409T probably benign Het
Mfsd11 T C 11: 116,873,297 F368S probably damaging Het
Neb C A 2: 52,243,943 V3343F probably damaging Het
Nrp1 T G 8: 128,418,716 Y84* probably null Het
Olfr722 G A 14: 49,895,254 Q183* probably null Het
Pate2 T A 9: 35,669,695 F2I probably damaging Het
Pla2r1 T A 2: 60,534,762 T155S probably benign Het
Slc28a2 T A 2: 122,460,531 C659* probably null Het
Wdr19 A T 5: 65,256,391 I1226F possibly damaging Het
Other mutations in Tram1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Tram1 APN 1 13579449 critical splice donor site probably null
IGL03071:Tram1 APN 1 13579774 nonsense probably null
IGL03123:Tram1 APN 1 13589605 missense probably benign 0.01
R0764:Tram1 UTSW 1 13579709 missense probably damaging 1.00
R1775:Tram1 UTSW 1 13576456 unclassified probably benign
R3877:Tram1 UTSW 1 13569603 missense probably benign 0.01
R4077:Tram1 UTSW 1 13566375 missense probably benign
R4747:Tram1 UTSW 1 13589646 missense probably damaging 1.00
R5197:Tram1 UTSW 1 13571902 missense probably benign 0.19
R5213:Tram1 UTSW 1 13579742 missense probably damaging 1.00
R5224:Tram1 UTSW 1 13578125 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TCAACTATGCCAACTGAAGCCAGTC -3'
(R):5'- GCTGGGTCATCACCATCAGATCAC -3'

Sequencing Primer
(F):5'- TCATGGCTGACTGCACAC -3'
(R):5'- GGTCATCACCATCAGATCACAGTAG -3'
Posted On2014-04-24