Incidental Mutation 'R1626:Igfn1'
ID172468
Institutional Source Beutler Lab
Gene Symbol Igfn1
Ensembl Gene ENSMUSG00000051985
Gene Nameimmunoglobulin-like and fibronectin type III domain containing 1
Synonyms9830123M21Rik
MMRRC Submission 039663-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R1626 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location135953578-136006342 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 135968967 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1287 (M1287K)
Ref Sequence ENSEMBL: ENSMUSP00000129680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166193]
Predicted Effect probably benign
Transcript: ENSMUST00000124134
SMART Domains Protein: ENSMUSP00000119230
Gene: ENSMUSG00000051985

DomainStartEndE-ValueType
IG 73 159 1.29e-6 SMART
IG_like 258 344 5.45e1 SMART
IG 354 435 1.79e0 SMART
IG 445 524 3.54e-4 SMART
IG 538 624 4.86e-2 SMART
FN3 627 711 3.99e-10 SMART
FN3 727 810 9.1e-14 SMART
FN3 828 911 1.5e-14 SMART
IG 938 1021 6.41e-2 SMART
FN3 1024 1106 3.2e-9 SMART
IGc2 1152 1219 4.89e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166193
AA Change: M1287K

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129680
Gene: ENSMUSG00000051985
AA Change: M1287K

DomainStartEndE-ValueType
low complexity region 90 101 N/A INTRINSIC
IG 193 279 1.29e-6 SMART
PDB:2LHU|A 302 365 8e-7 PDB
IG_like 378 464 5.45e1 SMART
IG 474 555 1.79e0 SMART
low complexity region 724 739 N/A INTRINSIC
internal_repeat_2 838 1006 9.98e-5 PROSPERO
low complexity region 1067 1084 N/A INTRINSIC
internal_repeat_2 1812 1967 9.98e-5 PROSPERO
Pfam:I-set 2054 2139 6.2e-8 PFAM
IG 2153 2239 4.86e-2 SMART
FN3 2242 2326 3.99e-10 SMART
FN3 2342 2425 9.1e-14 SMART
FN3 2443 2526 1.5e-14 SMART
IG 2553 2636 6.41e-2 SMART
FN3 2639 2721 3.2e-9 SMART
IGc2 2767 2834 4.89e-7 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T C 10: 21,621,672 Y71H possibly damaging Het
Acsl6 C A 11: 54,352,046 P628T probably damaging Het
Ak7 A G 12: 105,768,548 D591G probably benign Het
Anxa5 T C 3: 36,461,981 D66G probably damaging Het
Cacna1b G A 2: 24,606,709 T2283I probably damaging Het
Cand1 A T 10: 119,210,014 D995E possibly damaging Het
Cblc G T 7: 19,796,502 A94E probably damaging Het
Cd48 G A 1: 171,682,119 C9Y probably benign Het
Chd9 A G 8: 90,994,596 K1004R probably benign Het
Cldn1 T C 16: 26,371,452 T59A probably damaging Het
Col11a1 G A 3: 114,131,569 G17D probably damaging Het
Cpeb1 A G 7: 81,436,247 V49A probably damaging Het
Cyp4b1 G T 4: 115,641,658 P109Q probably damaging Het
Dhrs7b T A 11: 60,844,256 F23I possibly damaging Het
Dnah9 C A 11: 66,085,267 A1319S probably benign Het
Egf A T 3: 129,686,215 V553D possibly damaging Het
Fbn1 T C 2: 125,341,279 D1760G probably damaging Het
Fbxo31 A G 8: 121,560,006 F178L probably damaging Het
Fstl4 C A 11: 53,000,290 S85* probably null Het
Gfm1 A G 3: 67,438,644 Y225C probably damaging Het
Gm10797 A T 10: 67,572,623 noncoding transcript Het
Heatr4 T A 12: 83,973,721 I499L probably benign Het
Hist1h3g G A 13: 23,535,551 V36M probably damaging Het
Ick A G 9: 78,150,637 Y156C probably damaging Het
Inpp5b C A 4: 124,783,903 D385E probably damaging Het
Lrrc9 A G 12: 72,495,661 probably null Het
Ltb4r1 A G 14: 55,767,242 M1V probably null Het
Macf1 T C 4: 123,471,534 I3145V probably benign Het
Man2a2 T C 7: 80,367,702 N277S probably damaging Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mgat4e A G 1: 134,541,278 Y343H probably benign Het
Noxred1 T C 12: 87,221,255 *367W probably null Het
Nupl1 A T 14: 60,242,627 L190* probably null Het
Olfml2a G T 2: 38,951,263 K270N probably damaging Het
Olfr368 A G 2: 37,332,762 probably null Het
Olfr850 A G 9: 19,478,199 L14P probably damaging Het
Phgdh G T 3: 98,316,409 Q359K probably benign Het
Plpp5 G T 8: 25,722,577 C200F possibly damaging Het
Pole A C 5: 110,293,369 I230L probably benign Het
Prtg A T 9: 72,844,911 D193V probably damaging Het
Ptgs2 G A 1: 150,103,868 probably null Het
Ptprz1 A T 6: 23,001,574 Q1221L probably benign Het
Rufy2 T C 10: 62,995,372 I204T probably benign Het
Rybp A G 6: 100,232,958 S115P possibly damaging Het
Samd13 A G 3: 146,662,726 V37A probably benign Het
Secisbp2l T G 2: 125,775,686 K24Q probably damaging Het
Sorbs2 A G 8: 45,769,854 Y198C probably damaging Het
Svil T G 18: 5,117,099 probably null Het
Ttc24 G T 3: 88,070,059 R127S probably benign Het
Ttn C T 2: 76,758,544 V21394M probably damaging Het
Tubal3 G T 13: 3,932,841 C207F probably damaging Het
Vmn2r16 A T 5: 109,363,577 D550V probably damaging Het
Vmn2r2 T A 3: 64,134,500 I265F possibly damaging Het
Zfp507 T C 7: 35,795,433 K62E probably damaging Het
Other mutations in Igfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Igfn1 APN 1 135966726 missense probably damaging 1.00
IGL02299:Igfn1 APN 1 135954017
Bounty UTSW 1 135976917 critical splice donor site probably null
R0144:Igfn1 UTSW 1 135962013 missense probably damaging 0.99
R0190:Igfn1 UTSW 1 135962052 missense probably damaging 1.00
R0350:Igfn1 UTSW 1 135956767 nonsense probably null
R0413:Igfn1 UTSW 1 135967596 missense probably benign 0.23
R0504:Igfn1 UTSW 1 135968529 missense probably benign 0.00
R0606:Igfn1 UTSW 1 135959901 missense probably damaging 1.00
R0681:Igfn1 UTSW 1 135963853 missense possibly damaging 0.88
R0825:Igfn1 UTSW 1 135963126 missense probably damaging 1.00
R0839:Igfn1 UTSW 1 135954680 missense probably damaging 1.00
R1066:Igfn1 UTSW 1 135970725 missense probably benign
R1078:Igfn1 UTSW 1 135974847 missense probably damaging 1.00
R1224:Igfn1 UTSW 1 135969756 missense probably benign 0.07
R1569:Igfn1 UTSW 1 135969033 missense probably benign
R1663:Igfn1 UTSW 1 135968308 missense probably benign 0.15
R1677:Igfn1 UTSW 1 135971101 missense probably damaging 0.99
R1709:Igfn1 UTSW 1 135955573 missense probably benign 0.24
R1728:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1728:Igfn1 UTSW 1 135968199 missense probably benign
R1728:Igfn1 UTSW 1 135970411 missense probably benign
R1728:Igfn1 UTSW 1 135972127 missense probably benign
R1728:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1728:Igfn1 UTSW 1 135982475 missense probably benign
R1728:Igfn1 UTSW 1 135998625 missense probably benign
R1728:Igfn1 UTSW 1 135998683 missense unknown
R1729:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1729:Igfn1 UTSW 1 135968199 missense probably benign
R1729:Igfn1 UTSW 1 135970411 missense probably benign
R1729:Igfn1 UTSW 1 135972127 missense probably benign
R1729:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1729:Igfn1 UTSW 1 135982475 missense probably benign
R1729:Igfn1 UTSW 1 135998625 missense probably benign
R1729:Igfn1 UTSW 1 135998683 missense unknown
R1730:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1730:Igfn1 UTSW 1 135968199 missense probably benign
R1730:Igfn1 UTSW 1 135970411 missense probably benign
R1730:Igfn1 UTSW 1 135972127 missense probably benign
R1730:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1730:Igfn1 UTSW 1 135982475 missense probably benign
R1730:Igfn1 UTSW 1 135998625 missense probably benign
R1730:Igfn1 UTSW 1 135998683 missense unknown
R1739:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1739:Igfn1 UTSW 1 135968199 missense probably benign
R1739:Igfn1 UTSW 1 135970411 missense probably benign
R1739:Igfn1 UTSW 1 135972127 missense probably benign
R1739:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1739:Igfn1 UTSW 1 135982475 missense probably benign
R1739:Igfn1 UTSW 1 135998625 missense probably benign
R1739:Igfn1 UTSW 1 135998683 missense unknown
R1746:Igfn1 UTSW 1 135969823 missense possibly damaging 0.88
R1762:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1762:Igfn1 UTSW 1 135968199 missense probably benign
R1762:Igfn1 UTSW 1 135970411 missense probably benign
R1762:Igfn1 UTSW 1 135972127 missense probably benign
R1762:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1762:Igfn1 UTSW 1 135982475 missense probably benign
R1762:Igfn1 UTSW 1 135998625 missense probably benign
R1762:Igfn1 UTSW 1 135998683 missense unknown
R1783:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1783:Igfn1 UTSW 1 135968199 missense probably benign
R1783:Igfn1 UTSW 1 135970411 missense probably benign
R1783:Igfn1 UTSW 1 135972127 missense probably benign
R1783:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1783:Igfn1 UTSW 1 135982475 missense probably benign
R1783:Igfn1 UTSW 1 135998625 missense probably benign
R1783:Igfn1 UTSW 1 135998683 missense unknown
R1784:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1784:Igfn1 UTSW 1 135968199 missense probably benign
R1784:Igfn1 UTSW 1 135970411 missense probably benign
R1784:Igfn1 UTSW 1 135972127 missense probably benign
R1784:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1784:Igfn1 UTSW 1 135982475 missense probably benign
R1784:Igfn1 UTSW 1 135998625 missense probably benign
R1784:Igfn1 UTSW 1 135998683 missense unknown
R1785:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1785:Igfn1 UTSW 1 135968199 missense probably benign
R1785:Igfn1 UTSW 1 135970411 missense probably benign
R1785:Igfn1 UTSW 1 135972127 missense probably benign
R1785:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1785:Igfn1 UTSW 1 135982475 missense probably benign
R1785:Igfn1 UTSW 1 135998625 missense probably benign
R1785:Igfn1 UTSW 1 135998683 missense unknown
R1847:Igfn1 UTSW 1 135969388 missense probably benign
R1866:Igfn1 UTSW 1 135974868 intron probably null
R1921:Igfn1 UTSW 1 135966063 critical splice donor site probably null
R1984:Igfn1 UTSW 1 135962044 missense probably benign 0.39
R2049:Igfn1 UTSW 1 135970638 missense probably benign
R2049:Igfn1 UTSW 1 135974852 splice site probably benign
R2098:Igfn1 UTSW 1 135978305 missense probably damaging 1.00
R2130:Igfn1 UTSW 1 135974852 splice site probably benign
R2141:Igfn1 UTSW 1 135974852 splice site probably benign
R2276:Igfn1 UTSW 1 135964741 missense probably damaging 0.98
R2425:Igfn1 UTSW 1 135963102 missense probably damaging 1.00
R2483:Igfn1 UTSW 1 135969537 missense probably benign
R2504:Igfn1 UTSW 1 135969316 missense probably benign 0.07
R3109:Igfn1 UTSW 1 135997848 missense probably benign 0.12
R3421:Igfn1 UTSW 1 135976917 critical splice donor site probably null
R3423:Igfn1 UTSW 1 135998641 missense probably benign 0.01
R3705:Igfn1 UTSW 1 135968409 missense probably benign
R3871:Igfn1 UTSW 1 135968836 missense probably benign 0.03
R3875:Igfn1 UTSW 1 135954614 missense probably damaging 1.00
R3953:Igfn1 UTSW 1 135967180 missense possibly damaging 0.61
R3955:Igfn1 UTSW 1 135967180 missense possibly damaging 0.61
R3957:Igfn1 UTSW 1 135967180 missense possibly damaging 0.61
R3965:Igfn1 UTSW 1 135967819 missense probably benign
R4006:Igfn1 UTSW 1 135982362 splice site probably null
R4058:Igfn1 UTSW 1 135969756 missense probably benign 0.07
R4059:Igfn1 UTSW 1 135969756 missense probably benign 0.07
R4370:Igfn1 UTSW 1 135968106 missense probably benign 0.00
R4380:Igfn1 UTSW 1 135967771 missense probably benign 0.00
R4495:Igfn1 UTSW 1 135969678 missense possibly damaging 0.79
R4628:Igfn1 UTSW 1 135959730 missense possibly damaging 0.47
R4672:Igfn1 UTSW 1 135965369 missense possibly damaging 0.72
R4682:Igfn1 UTSW 1 135998625 missense probably benign
R4702:Igfn1 UTSW 1 135967209 missense possibly damaging 0.71
R4744:Igfn1 UTSW 1 135982458 missense probably benign 0.07
R4777:Igfn1 UTSW 1 135954862 missense probably benign
R4806:Igfn1 UTSW 1 135967357 missense probably benign 0.01
R4840:Igfn1 UTSW 1 135968040 missense probably benign 0.00
R4894:Igfn1 UTSW 1 135954782 missense probably damaging 1.00
R4998:Igfn1 UTSW 1 135954666 missense probably damaging 1.00
R5092:Igfn1 UTSW 1 135964826 missense probably benign
R5108:Igfn1 UTSW 1 135982441 missense probably benign
R5120:Igfn1 UTSW 1 135973502 missense possibly damaging 0.93
R5127:Igfn1 UTSW 1 135959896 missense probably damaging 1.00
R5231:Igfn1 UTSW 1 135966736 missense probably benign 0.26
R5286:Igfn1 UTSW 1 135967861 missense probably benign 0.10
R5307:Igfn1 UTSW 1 135964938 missense probably damaging 1.00
R5380:Igfn1 UTSW 1 135966087 missense probably damaging 1.00
R5553:Igfn1 UTSW 1 135967884 missense probably damaging 1.00
R5660:Igfn1 UTSW 1 135970414 missense probably benign 0.01
R5779:Igfn1 UTSW 1 135966840 missense probably benign 0.16
R5818:Igfn1 UTSW 1 135966126 missense possibly damaging 0.72
R5832:Igfn1 UTSW 1 135974795 missense probably damaging 0.96
R5933:Igfn1 UTSW 1 135970603 nonsense probably null
R5966:Igfn1 UTSW 1 135965414 missense probably damaging 1.00
R6116:Igfn1 UTSW 1 135970467 missense probably benign 0.00
R6297:Igfn1 UTSW 1 135964661 critical splice donor site probably null
R6652:Igfn1 UTSW 1 135963871 missense probably damaging 1.00
R6737:Igfn1 UTSW 1 135969867 missense probably benign
R6816:Igfn1 UTSW 1 135959728 missense probably benign 0.02
R6886:Igfn1 UTSW 1 135973460 missense probably damaging 1.00
R6888:Igfn1 UTSW 1 135982480 missense probably benign 0.33
R6975:Igfn1 UTSW 1 135968445 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATTGCCAGACACTTGAGCCCAG -3'
(R):5'- TTTCAAGGCCACGGTCAGACAG -3'

Sequencing Primer
(F):5'- CCAGTGGCCCTCTGAAC -3'
(R):5'- CATTGGAGAGCACCACTGTG -3'
Posted On2014-04-24