Incidental Mutation 'R1626:Fbxo31'
ID172503
Institutional Source Beutler Lab
Gene Symbol Fbxo31
Ensembl Gene ENSMUSG00000052934
Gene NameF-box protein 31
Synonyms1110003O08Rik, Fbx14, Fbxo14, 2310046N15Rik
MMRRC Submission 039663-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.747) question?
Stock #R1626 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location121549440-121578806 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121560006 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 178 (F178L)
Ref Sequence ENSEMBL: ENSMUSP00000057573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059018] [ENSMUST00000127664]
Predicted Effect probably damaging
Transcript: ENSMUST00000059018
AA Change: F178L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057573
Gene: ENSMUSG00000052934
AA Change: F178L

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
low complexity region 25 42 N/A INTRINSIC
FBOX 56 96 3.45e-8 SMART
low complexity region 358 379 N/A INTRINSIC
low complexity region 385 412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181663
SMART Domains Protein: ENSMUSP00000137907
Gene: ENSMUSG00000052934

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
low complexity region 25 42 N/A INTRINSIC
FBOX 56 96 3.45e-8 SMART
transmembrane domain 156 178 N/A INTRINSIC
low complexity region 190 201 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212985
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the F-box family. Members are classified into three classes according to the substrate interaction domain, FBW for WD40 repeats, FBL for leucing-rich repeats, and FBXO for other domains. This protein, classified into the last category because of the lack of a recognizable substrate binding domain, has been proposed to be a component of the SCF ubiquitination complex. It is thought to bind and recruit substrate for ubiquitination and degradation. This protein may have a role in regulating the cell cycle as well as dendrite growth and neuronal migration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T C 10: 21,621,672 Y71H possibly damaging Het
Acsl6 C A 11: 54,352,046 P628T probably damaging Het
Ak7 A G 12: 105,768,548 D591G probably benign Het
Anxa5 T C 3: 36,461,981 D66G probably damaging Het
Cacna1b G A 2: 24,606,709 T2283I probably damaging Het
Cand1 A T 10: 119,210,014 D995E possibly damaging Het
Cblc G T 7: 19,796,502 A94E probably damaging Het
Cd48 G A 1: 171,682,119 C9Y probably benign Het
Chd9 A G 8: 90,994,596 K1004R probably benign Het
Cldn1 T C 16: 26,371,452 T59A probably damaging Het
Col11a1 G A 3: 114,131,569 G17D probably damaging Het
Cpeb1 A G 7: 81,436,247 V49A probably damaging Het
Cyp4b1 G T 4: 115,641,658 P109Q probably damaging Het
Dhrs7b T A 11: 60,844,256 F23I possibly damaging Het
Dnah9 C A 11: 66,085,267 A1319S probably benign Het
Egf A T 3: 129,686,215 V553D possibly damaging Het
Fbn1 T C 2: 125,341,279 D1760G probably damaging Het
Fstl4 C A 11: 53,000,290 S85* probably null Het
Gfm1 A G 3: 67,438,644 Y225C probably damaging Het
Gm10797 A T 10: 67,572,623 noncoding transcript Het
Heatr4 T A 12: 83,973,721 I499L probably benign Het
Hist1h3g G A 13: 23,535,551 V36M probably damaging Het
Ick A G 9: 78,150,637 Y156C probably damaging Het
Igfn1 A T 1: 135,968,967 M1287K probably benign Het
Inpp5b C A 4: 124,783,903 D385E probably damaging Het
Lrrc9 A G 12: 72,495,661 probably null Het
Ltb4r1 A G 14: 55,767,242 M1V probably null Het
Macf1 T C 4: 123,471,534 I3145V probably benign Het
Man2a2 T C 7: 80,367,702 N277S probably damaging Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mgat4e A G 1: 134,541,278 Y343H probably benign Het
Noxred1 T C 12: 87,221,255 *367W probably null Het
Nupl1 A T 14: 60,242,627 L190* probably null Het
Olfml2a G T 2: 38,951,263 K270N probably damaging Het
Olfr368 A G 2: 37,332,762 probably null Het
Olfr850 A G 9: 19,478,199 L14P probably damaging Het
Phgdh G T 3: 98,316,409 Q359K probably benign Het
Plpp5 G T 8: 25,722,577 C200F possibly damaging Het
Pole A C 5: 110,293,369 I230L probably benign Het
Prtg A T 9: 72,844,911 D193V probably damaging Het
Ptgs2 G A 1: 150,103,868 probably null Het
Ptprz1 A T 6: 23,001,574 Q1221L probably benign Het
Rufy2 T C 10: 62,995,372 I204T probably benign Het
Rybp A G 6: 100,232,958 S115P possibly damaging Het
Samd13 A G 3: 146,662,726 V37A probably benign Het
Secisbp2l T G 2: 125,775,686 K24Q probably damaging Het
Sorbs2 A G 8: 45,769,854 Y198C probably damaging Het
Svil T G 18: 5,117,099 probably null Het
Ttc24 G T 3: 88,070,059 R127S probably benign Het
Ttn C T 2: 76,758,544 V21394M probably damaging Het
Tubal3 G T 13: 3,932,841 C207F probably damaging Het
Vmn2r16 A T 5: 109,363,577 D550V probably damaging Het
Vmn2r2 T A 3: 64,134,500 I265F possibly damaging Het
Zfp507 T C 7: 35,795,433 K62E probably damaging Het
Other mutations in Fbxo31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Fbxo31 APN 8 121554330 missense possibly damaging 0.92
IGL02155:Fbxo31 APN 8 121559075 missense probably damaging 1.00
IGL02551:Fbxo31 APN 8 121566344 missense probably damaging 0.99
IGL03092:Fbxo31 APN 8 121560018 missense probably benign
R0377:Fbxo31 UTSW 8 121559102 unclassified probably benign
R0730:Fbxo31 UTSW 8 121555364 unclassified probably benign
R1132:Fbxo31 UTSW 8 121552276 frame shift probably null
R1132:Fbxo31 UTSW 8 121552280 frame shift probably null
R1796:Fbxo31 UTSW 8 121560438 nonsense probably null
R2215:Fbxo31 UTSW 8 121566311 missense probably benign 0.01
R3726:Fbxo31 UTSW 8 121578509 missense probably damaging 1.00
R3761:Fbxo31 UTSW 8 121560430 missense possibly damaging 0.94
R4646:Fbxo31 UTSW 8 121560016 missense probably benign
R4782:Fbxo31 UTSW 8 121552439 nonsense probably null
R4782:Fbxo31 UTSW 8 121552441 missense probably damaging 1.00
R5103:Fbxo31 UTSW 8 121552362 missense probably damaging 1.00
R5715:Fbxo31 UTSW 8 121578563 missense probably damaging 1.00
R6347:Fbxo31 UTSW 8 121578459 missense possibly damaging 0.69
R6551:Fbxo31 UTSW 8 121564704 intron probably benign
Predicted Primers PCR Primer
(F):5'- CCGGGTCATGGTAGAACTGTGAAAG -3'
(R):5'- ACCGATACAGACACATTTTGGGGC -3'

Sequencing Primer
(F):5'- TGGTAGAACTGTGAAAGGCTGTG -3'
(R):5'- CCAGATGTTACTTTCGGAGTGAAC -3'
Posted On2014-04-24