Incidental Mutation 'R1627:Vmn2r80'
ID172565
Institutional Source Beutler Lab
Gene Symbol Vmn2r80
Ensembl Gene ENSMUSG00000091888
Gene Namevomeronasal 2, receptor 80
SynonymsEG624765
MMRRC Submission 039664-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R1627 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location79148797-79195012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79194415 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 692 (R692G)
Ref Sequence ENSEMBL: ENSMUSP00000132299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165834]
Predicted Effect probably damaging
Transcript: ENSMUST00000165834
AA Change: R692G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132299
Gene: ENSMUSG00000091888
AA Change: R692G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 79 474 1.5e-36 PFAM
Pfam:NCD3G 517 570 7.9e-22 PFAM
Pfam:7tm_3 603 838 6.2e-49 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,936,014 M630T probably benign Het
Anpep T C 7: 79,842,011 I81V probably benign Het
Bub1 A G 2: 127,809,013 S627P probably benign Het
C1s1 T A 6: 124,537,480 N139I probably damaging Het
Car6 A T 4: 150,192,578 V152D probably damaging Het
Cdh19 C A 1: 110,919,645 M411I probably benign Het
Cep95 A G 11: 106,809,705 E322G probably damaging Het
Chek1 C A 9: 36,714,441 V303L probably benign Het
Dctn1 T A 6: 83,195,082 I818N probably damaging Het
Dscaml1 T C 9: 45,753,147 S2107P probably damaging Het
Dusp14 A G 11: 84,048,771 I148T probably damaging Het
Eps15 A G 4: 109,370,557 D645G probably damaging Het
Etl4 A G 2: 20,801,579 N1153S possibly damaging Het
Fer1l6 A G 15: 58,641,879 D1541G probably benign Het
Gm14496 A G 2: 181,998,778 S513G probably damaging Het
H2-D1 G T 17: 35,263,495 A64S possibly damaging Het
Hsd17b2 T A 8: 117,702,170 F59I possibly damaging Het
Itgb7 T G 15: 102,223,476 Q224P probably damaging Het
Jak1 A G 4: 101,191,624 probably null Het
Kdm1b G A 13: 47,064,231 probably null Het
Lrp8 A G 4: 107,854,416 I466V probably damaging Het
Mga A G 2: 119,964,562 D2909G probably damaging Het
Nol8 T C 13: 49,661,504 S345P probably benign Het
Nup210l T C 3: 90,144,169 M540T probably benign Het
Obscn C T 11: 59,112,638 R1370H probably benign Het
Olfr1368 A G 13: 21,142,955 F34S probably damaging Het
Pbx3 A G 2: 34,175,953 V375A probably benign Het
Ppp1r9a T C 6: 4,906,168 V241A possibly damaging Het
Psmd6 C T 14: 14,112,539 V354M probably damaging Het
Rab2a T C 4: 8,578,481 F94L probably damaging Het
Rev1 T C 1: 38,055,490 D949G probably damaging Het
Ric8a A G 7: 140,858,178 D110G probably damaging Het
Rlf A T 4: 121,150,000 D594E probably benign Het
Sept1 C A 7: 127,218,058 probably null Het
Slco5a1 G C 1: 12,990,383 P38R probably damaging Het
Snx33 C A 9: 56,925,957 R276L probably damaging Het
Taf11 A T 17: 27,905,279 D101E probably benign Het
Ttn A G 2: 76,934,220 S3168P probably damaging Het
Uggt2 T C 14: 119,057,663 E41G possibly damaging Het
Zfp763 A T 17: 33,021,784 W24R probably damaging Het
Other mutations in Vmn2r80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Vmn2r80 APN 10 79194599 missense probably damaging 1.00
IGL01325:Vmn2r80 APN 10 79194247 missense possibly damaging 0.62
IGL01611:Vmn2r80 APN 10 79171654 missense probably damaging 1.00
IGL01799:Vmn2r80 APN 10 79171551 missense possibly damaging 0.95
IGL01877:Vmn2r80 APN 10 79171500 splice site probably null
IGL02673:Vmn2r80 APN 10 79169484 missense probably benign 0.02
IGL02756:Vmn2r80 APN 10 79194311 missense probably damaging 1.00
IGL02820:Vmn2r80 APN 10 79171605 missense probably benign 0.04
IGL03382:Vmn2r80 APN 10 79169528 missense probably damaging 1.00
R0071:Vmn2r80 UTSW 10 79171732 missense possibly damaging 0.83
R0071:Vmn2r80 UTSW 10 79171732 missense possibly damaging 0.83
R0129:Vmn2r80 UTSW 10 79169496 missense probably damaging 1.00
R0325:Vmn2r80 UTSW 10 79148939 missense possibly damaging 0.89
R0567:Vmn2r80 UTSW 10 79194831 missense possibly damaging 0.89
R1510:Vmn2r80 UTSW 10 79169719 missense possibly damaging 0.69
R1519:Vmn2r80 UTSW 10 79194219 missense probably damaging 1.00
R1520:Vmn2r80 UTSW 10 79194760 missense probably damaging 1.00
R1709:Vmn2r80 UTSW 10 79194389 missense probably benign 0.04
R2116:Vmn2r80 UTSW 10 79194724 missense probably benign 0.09
R2237:Vmn2r80 UTSW 10 79168270 missense probably damaging 1.00
R2308:Vmn2r80 UTSW 10 79171621 missense probably damaging 1.00
R2893:Vmn2r80 UTSW 10 79148865 missense possibly damaging 0.63
R3408:Vmn2r80 UTSW 10 79168393 missense possibly damaging 0.95
R4502:Vmn2r80 UTSW 10 79148930 missense probably benign 0.00
R4685:Vmn2r80 UTSW 10 79194328 missense possibly damaging 0.95
R4851:Vmn2r80 UTSW 10 79194322 missense possibly damaging 0.68
R4947:Vmn2r80 UTSW 10 79194698 missense probably damaging 1.00
R5112:Vmn2r80 UTSW 10 79194458 missense possibly damaging 0.61
R5217:Vmn2r80 UTSW 10 79169146 missense possibly damaging 0.62
R5226:Vmn2r80 UTSW 10 79194040 missense probably benign 0.36
R5512:Vmn2r80 UTSW 10 79168232 missense probably benign 0.00
R5618:Vmn2r80 UTSW 10 79148921 missense probably benign
R5959:Vmn2r80 UTSW 10 79169479 missense probably benign 0.00
R6104:Vmn2r80 UTSW 10 79149020 missense probably benign 0.00
R6110:Vmn2r80 UTSW 10 79182003 missense probably damaging 1.00
R6270:Vmn2r80 UTSW 10 79194325 missense probably benign 0.00
R6508:Vmn2r80 UTSW 10 79194456 missense probably benign 0.03
R6843:Vmn2r80 UTSW 10 79169668 missense probably benign 0.08
R6894:Vmn2r80 UTSW 10 79169604 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGGTATTTGTAGACCACAGAGGCAC -3'
(R):5'- GAGGTAACTCCCAAAGGCCATGAC -3'

Sequencing Primer
(F):5'- ATAGATCCCTCAGTTACATACTGC -3'
(R):5'- TGACTCCCAGGTAAGCCAGAG -3'
Posted On2014-04-24