Incidental Mutation 'R1628:B3galnt1'
ID172588
Institutional Source Beutler Lab
Gene Symbol B3galnt1
Ensembl Gene ENSMUSG00000043300
Gene NameUDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 1
SynonymsBrainiac 1, B3galt3, Globoside blood group, Mbrn 1
MMRRC Submission 039665-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R1628 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location69574158-69598960 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 69575628 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 100 (T100I)
Ref Sequence ENSEMBL: ENSMUSP00000058363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061826]
Predicted Effect probably damaging
Transcript: ENSMUST00000061826
AA Change: T100I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058363
Gene: ENSMUSG00000043300
AA Change: T100I

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Galactosyl_T 92 285 4.5e-68 PFAM
Meta Mutation Damage Score 0.416 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the beta-1,3-galactosyltransferase (beta3GalT) gene family. This family encodes type II membrane-bound glycoproteins with diverse enzymatic functions using different donor substrates (UDP-galactose and UDP-N-acetylglucosamine) and different acceptor sugars (N-acetylglucosamine, galactose, N-acetylgalactosamine). The beta3GalT genes are distantly related to the Drosophila Brainiac gene and have the protein coding sequence contained in a single exon. The beta3GalT proteins also contain conserved sequences not found in the beta4GalT or alpha3GalT proteins. The carbohydrate chains synthesized by these enzymes are designated as type 1, whereas beta4GalT enzymes synthesize type 2 carbohydrate chains. The ratio of type 1:type 2 chains changes during embryogenesis. By sequence similarity, the beta3GalT genes fall into at least two groups: beta3GalT4 and 4 other beta3GalT genes (beta3GalT1-3, beta3GalT5). The encoded protein of this gene does not use N-acetylglucosamine as an acceptor sugar at all. [provided by RefSeq, Mar 2017]
PHENOTYPE: A homozygous null mutation of this gene results in embryonic lethality. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 C T 17: 84,691,991 Q172* probably null Het
AI467606 G A 7: 127,092,583 G110D probably benign Het
Arhgef15 A C 11: 68,944,814 L805R possibly damaging Het
Bod1l T A 5: 41,816,982 M2330L probably benign Het
Calcr A T 6: 3,700,251 H280Q possibly damaging Het
Camk1d T C 2: 5,311,037 D263G probably damaging Het
Cd48 T A 1: 171,704,852 I233N probably damaging Het
Cyp3a25 A T 5: 146,001,463 Y68* probably null Het
Dapk3 C A 10: 81,191,809 T227K possibly damaging Het
Dnajc22 A G 15: 99,100,936 M1V probably null Het
Etv5 C T 16: 22,401,671 probably null Het
Gabrr1 A G 4: 33,152,432 Y124C probably damaging Het
Gba2 C T 4: 43,570,118 R392Q probably benign Het
Gli3 C G 13: 15,726,312 A1428G probably benign Het
Gls G A 1: 52,232,676 A106V probably benign Het
Gm1966 A T 7: 106,603,269 L256* probably null Het
Gm21370 A G 13: 120,026,878 V45A possibly damaging Het
Gm8765 T C 13: 50,702,288 L654P probably benign Het
Gpr4 A G 7: 19,223,199 T349A probably benign Het
Gpr6 C T 10: 41,071,548 V13M possibly damaging Het
Hectd3 A G 4: 116,997,392 H345R probably damaging Het
Igfl3 A T 7: 18,180,307 K135N probably benign Het
Il23r A G 6: 67,423,609 L579S probably damaging Het
Itsn2 A C 12: 4,629,652 M154L probably benign Het
Junb T A 8: 84,978,410 Q7L possibly damaging Het
Kif21b T A 1: 136,171,220 H1415Q probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhdc10 T G 6: 30,444,462 F79L probably damaging Het
Klk1b8 A G 7: 43,954,141 probably null Het
Lmbrd2 T A 15: 9,182,506 N509K probably damaging Het
Mctp2 A G 7: 72,211,589 probably null Het
Myo3b A G 2: 70,286,962 N913S probably benign Het
N4bp2 G A 5: 65,803,572 probably null Het
Nt5c1a A G 4: 123,208,491 E70G possibly damaging Het
Olfr358 A G 2: 37,004,726 V296A probably damaging Het
Papln A G 12: 83,784,406 probably benign Het
Pcnx3 G T 19: 5,686,065 S244R probably damaging Het
Pecam1 A T 11: 106,682,960 probably null Het
Plppr4 A T 3: 117,328,272 L219Q probably damaging Het
Ppp2r5b A G 19: 6,230,905 probably null Het
Ralgapb A G 2: 158,430,463 R146G probably benign Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rfpl4b T G 10: 38,821,534 I24L probably benign Het
Serpinb1b G A 13: 33,093,654 C290Y probably benign Het
Slc25a17 A G 15: 81,360,724 S3P possibly damaging Het
Slc4a11 A C 2: 130,687,127 probably null Het
Sptb A G 12: 76,583,848 Y2231H probably damaging Het
Srgap1 T G 10: 121,870,339 M221L probably benign Het
Srgap3 A G 6: 112,739,370 L599P probably damaging Het
Svep1 C T 4: 58,107,561 V1177M probably benign Het
Tarbp1 A G 8: 126,430,860 F1303L possibly damaging Het
Tbxa2r T C 10: 81,334,507 S276P possibly damaging Het
Try10 A T 6: 41,357,456 D194V probably damaging Het
Ttc37 A G 13: 76,111,791 E70G possibly damaging Het
Ttc39c T C 18: 12,734,879 probably benign Het
Ttc8 G A 12: 98,982,521 V489M probably benign Het
Unc13b G T 4: 43,263,371 R1912L probably damaging Het
Unc45b T A 11: 82,929,380 probably null Het
Usp17lb T C 7: 104,840,841 Y292C probably damaging Het
Usp34 A G 11: 23,488,725 D3429G probably damaging Het
Usp42 A G 5: 143,717,367 S500P probably damaging Het
Vmn2r14 T C 5: 109,219,972 M385V probably benign Het
Vmn2r60 G A 7: 42,136,406 W211* probably null Het
Vwf A T 6: 125,647,738 probably benign Het
Wdfy4 A T 14: 32,959,961 F3018I probably damaging Het
Wwox A G 8: 114,448,233 T102A probably benign Het
Zfp142 A C 1: 74,571,888 L813R possibly damaging Het
Zfp407 G A 18: 84,354,533 T1670M probably damaging Het
Zfp93 A G 7: 24,274,857 E89G probably benign Het
Zwint C T 10: 72,656,295 Q18* probably null Het
Other mutations in B3galnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0101:B3galnt1 UTSW 3 69575806 missense probably benign 0.01
R0230:B3galnt1 UTSW 3 69575340 missense possibly damaging 0.80
R1580:B3galnt1 UTSW 3 69575707 missense possibly damaging 0.95
R1942:B3galnt1 UTSW 3 69575925 start codon destroyed probably null 0.90
R5137:B3galnt1 UTSW 3 69574949 missense probably benign 0.01
R6418:B3galnt1 UTSW 3 69574993 missense probably damaging 1.00
R6468:B3galnt1 UTSW 3 69575533 missense probably damaging 1.00
R6473:B3galnt1 UTSW 3 69575340 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GCATTGGGGCAAAACTCCATTACC -3'
(R):5'- CCTGTAGAACCTGTGCCTTCTGAAC -3'

Sequencing Primer
(F):5'- GCCATAATGGTTTTCAAGGTCAAG -3'
(R):5'- GGATGTCACTGAGATCCCTCAAG -3'
Posted On2014-04-24