Incidental Mutation 'R1628:Vmn2r60'
ID172613
Institutional Source Beutler Lab
Gene Symbol Vmn2r60
Ensembl Gene ENSMUSG00000090619
Gene Namevomeronasal 2, receptor 60
SynonymsGprc2a-rs3, Casr-rs3, EG637898
MMRRC Submission 039665-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R1628 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location42116471-42195776 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 42136406 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 211 (W211*)
Ref Sequence ENSEMBL: ENSMUSP00000128493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166447]
Predicted Effect probably null
Transcript: ENSMUST00000166447
AA Change: W211*
SMART Domains Protein: ENSMUSP00000128493
Gene: ENSMUSG00000090619
AA Change: W211*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 78 471 1.2e-44 PFAM
Pfam:NCD3G 514 567 5.1e-23 PFAM
Pfam:7tm_3 600 835 1.4e-51 PFAM
Meta Mutation Damage Score 0.6484 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 C T 17: 84,691,991 Q172* probably null Het
AI467606 G A 7: 127,092,583 G110D probably benign Het
Arhgef15 A C 11: 68,944,814 L805R possibly damaging Het
B3galnt1 G A 3: 69,575,628 T100I probably damaging Het
Bod1l T A 5: 41,816,982 M2330L probably benign Het
Calcr A T 6: 3,700,251 H280Q possibly damaging Het
Camk1d T C 2: 5,311,037 D263G probably damaging Het
Cd48 T A 1: 171,704,852 I233N probably damaging Het
Cyp3a25 A T 5: 146,001,463 Y68* probably null Het
Dapk3 C A 10: 81,191,809 T227K possibly damaging Het
Dnajc22 A G 15: 99,100,936 M1V probably null Het
Etv5 C T 16: 22,401,671 probably null Het
Gabrr1 A G 4: 33,152,432 Y124C probably damaging Het
Gba2 C T 4: 43,570,118 R392Q probably benign Het
Gli3 C G 13: 15,726,312 A1428G probably benign Het
Gls G A 1: 52,232,676 A106V probably benign Het
Gm1966 A T 7: 106,603,269 L256* probably null Het
Gm21370 A G 13: 120,026,878 V45A possibly damaging Het
Gm8765 T C 13: 50,702,288 L654P probably benign Het
Gpr4 A G 7: 19,223,199 T349A probably benign Het
Gpr6 C T 10: 41,071,548 V13M possibly damaging Het
Hectd3 A G 4: 116,997,392 H345R probably damaging Het
Igfl3 A T 7: 18,180,307 K135N probably benign Het
Il23r A G 6: 67,423,609 L579S probably damaging Het
Itsn2 A C 12: 4,629,652 M154L probably benign Het
Junb T A 8: 84,978,410 Q7L possibly damaging Het
Kif21b T A 1: 136,171,220 H1415Q probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhdc10 T G 6: 30,444,462 F79L probably damaging Het
Klk1b8 A G 7: 43,954,141 probably null Het
Lmbrd2 T A 15: 9,182,506 N509K probably damaging Het
Mctp2 A G 7: 72,211,589 probably null Het
Myo3b A G 2: 70,286,962 N913S probably benign Het
N4bp2 G A 5: 65,803,572 probably null Het
Nt5c1a A G 4: 123,208,491 E70G possibly damaging Het
Olfr358 A G 2: 37,004,726 V296A probably damaging Het
Papln A G 12: 83,784,406 probably benign Het
Pcnx3 G T 19: 5,686,065 S244R probably damaging Het
Pecam1 A T 11: 106,682,960 probably null Het
Plppr4 A T 3: 117,328,272 L219Q probably damaging Het
Ppp2r5b A G 19: 6,230,905 probably null Het
Ralgapb A G 2: 158,430,463 R146G probably benign Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rfpl4b T G 10: 38,821,534 I24L probably benign Het
Serpinb1b G A 13: 33,093,654 C290Y probably benign Het
Slc25a17 A G 15: 81,360,724 S3P possibly damaging Het
Slc4a11 A C 2: 130,687,127 probably null Het
Sptb A G 12: 76,583,848 Y2231H probably damaging Het
Srgap1 T G 10: 121,870,339 M221L probably benign Het
Srgap3 A G 6: 112,739,370 L599P probably damaging Het
Svep1 C T 4: 58,107,561 V1177M probably benign Het
Tarbp1 A G 8: 126,430,860 F1303L possibly damaging Het
Tbxa2r T C 10: 81,334,507 S276P possibly damaging Het
Try10 A T 6: 41,357,456 D194V probably damaging Het
Ttc37 A G 13: 76,111,791 E70G possibly damaging Het
Ttc39c T C 18: 12,734,879 probably benign Het
Ttc8 G A 12: 98,982,521 V489M probably benign Het
Unc13b G T 4: 43,263,371 R1912L probably damaging Het
Unc45b T A 11: 82,929,380 probably null Het
Usp17lb T C 7: 104,840,841 Y292C probably damaging Het
Usp34 A G 11: 23,488,725 D3429G probably damaging Het
Usp42 A G 5: 143,717,367 S500P probably damaging Het
Vmn2r14 T C 5: 109,219,972 M385V probably benign Het
Vwf A T 6: 125,647,738 probably benign Het
Wdfy4 A T 14: 32,959,961 F3018I probably damaging Het
Wwox A G 8: 114,448,233 T102A probably benign Het
Zfp142 A C 1: 74,571,888 L813R possibly damaging Het
Zfp407 G A 18: 84,354,533 T1670M probably damaging Het
Zfp93 A G 7: 24,274,857 E89G probably benign Het
Zwint C T 10: 72,656,295 Q18* probably null Het
Other mutations in Vmn2r60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Vmn2r60 APN 7 42136486 missense probably benign 0.09
IGL01623:Vmn2r60 APN 7 42136486 missense probably benign 0.09
IGL02363:Vmn2r60 APN 7 42195154 missense probably benign 0.02
IGL02485:Vmn2r60 APN 7 42195466 missense possibly damaging 0.54
IGL02651:Vmn2r60 APN 7 42195586 missense probably damaging 0.99
IGL02660:Vmn2r60 APN 7 42142296 nonsense probably null
IGL03135:Vmn2r60 APN 7 42136594 missense probably benign 0.13
IGL03307:Vmn2r60 APN 7 42116547 missense probably benign 0.14
R0310:Vmn2r60 UTSW 7 42195140 missense possibly damaging 0.54
R0314:Vmn2r60 UTSW 7 42135561 splice site probably benign
R0328:Vmn2r60 UTSW 7 42142320 splice site probably benign
R0464:Vmn2r60 UTSW 7 42135831 missense probably damaging 0.99
R0755:Vmn2r60 UTSW 7 42195445 missense probably damaging 1.00
R1119:Vmn2r60 UTSW 7 42194941 missense possibly damaging 0.68
R1162:Vmn2r60 UTSW 7 42195771 missense probably benign 0.29
R1241:Vmn2r60 UTSW 7 42137052 missense probably benign 0.01
R1404:Vmn2r60 UTSW 7 42136787 missense probably damaging 0.99
R1404:Vmn2r60 UTSW 7 42136787 missense probably damaging 0.99
R1488:Vmn2r60 UTSW 7 42136713 missense probably benign 0.17
R1623:Vmn2r60 UTSW 7 42135855 nonsense probably null
R1883:Vmn2r60 UTSW 7 42136670 missense probably damaging 0.99
R1884:Vmn2r60 UTSW 7 42136670 missense probably damaging 0.99
R2182:Vmn2r60 UTSW 7 42195507 missense probably benign 0.06
R2275:Vmn2r60 UTSW 7 42136827 nonsense probably null
R2847:Vmn2r60 UTSW 7 42136433 missense probably benign 0.07
R2885:Vmn2r60 UTSW 7 42140979 missense possibly damaging 0.91
R2894:Vmn2r60 UTSW 7 42135796 missense probably benign
R2921:Vmn2r60 UTSW 7 42141035 missense probably damaging 0.98
R2922:Vmn2r60 UTSW 7 42141035 missense probably damaging 0.98
R3772:Vmn2r60 UTSW 7 42116556 missense probably benign 0.35
R3820:Vmn2r60 UTSW 7 42135701 missense probably damaging 0.98
R3822:Vmn2r60 UTSW 7 42135701 missense probably damaging 0.98
R3872:Vmn2r60 UTSW 7 42136454 missense probably benign 0.19
R4222:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4223:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4224:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4526:Vmn2r60 UTSW 7 42195243 missense probably damaging 0.96
R4547:Vmn2r60 UTSW 7 42135663 missense probably null 0.54
R4840:Vmn2r60 UTSW 7 42135861 missense probably damaging 1.00
R5173:Vmn2r60 UTSW 7 42195511 missense probably damaging 0.97
R5231:Vmn2r60 UTSW 7 42137024 missense possibly damaging 0.93
R5480:Vmn2r60 UTSW 7 42135730 missense probably damaging 0.98
R5521:Vmn2r60 UTSW 7 42195625 missense probably damaging 0.99
R5834:Vmn2r60 UTSW 7 42116508 missense probably benign 0.17
R6038:Vmn2r60 UTSW 7 42194962 missense probably benign 0.04
R6038:Vmn2r60 UTSW 7 42194962 missense probably benign 0.04
R6112:Vmn2r60 UTSW 7 42195423 missense probably damaging 1.00
R6149:Vmn2r60 UTSW 7 42136976 missense probably damaging 1.00
R6170:Vmn2r60 UTSW 7 42135621 missense possibly damaging 0.94
R6383:Vmn2r60 UTSW 7 42116471 start codon destroyed probably null 0.04
R6811:Vmn2r60 UTSW 7 42194886 missense probably damaging 1.00
R6876:Vmn2r60 UTSW 7 42135663 missense probably null 0.54
R6997:Vmn2r60 UTSW 7 42142292 missense probably benign 0.00
R7040:Vmn2r60 UTSW 7 42142242 missense probably benign 0.00
R7116:Vmn2r60 UTSW 7 42137063 missense probably benign 0.00
R7128:Vmn2r60 UTSW 7 42195112 missense probably damaging 0.96
R7232:Vmn2r60 UTSW 7 42136742 missense possibly damaging 0.83
R7296:Vmn2r60 UTSW 7 42136402 missense probably benign 0.01
R7376:Vmn2r60 UTSW 7 42195207 missense probably damaging 1.00
X0023:Vmn2r60 UTSW 7 42141114 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGCGGCAATGGAGTCAATCACATATC -3'
(R):5'- GACCCAGACTTTCCATGTCACTAACAG -3'

Sequencing Primer
(F):5'- GGAGTCAATCACATATCAAAGAAATG -3'
(R):5'- ATGACATTTGCTGATGATTCCTC -3'
Posted On2014-04-24