Incidental Mutation 'R1629:Olfr1033'
ID172659
Institutional Source Beutler Lab
Gene Symbol Olfr1033
Ensembl Gene ENSMUSG00000045392
Gene Nameolfactory receptor 1033
SynonymsGA_x6K02T2Q125-47516301-47517233, MOR199-2
MMRRC Submission 039666-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R1629 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86020633-86045171 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86041422 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 36 (T36A)
Ref Sequence ENSEMBL: ENSMUSP00000150625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111589] [ENSMUST00000213496] [ENSMUST00000213774] [ENSMUST00000213865] [ENSMUST00000214546] [ENSMUST00000215682] [ENSMUST00000218397]
Predicted Effect probably damaging
Transcript: ENSMUST00000111589
AA Change: T36A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107216
Gene: ENSMUSG00000042796
AA Change: T36A

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.4e-50 PFAM
Pfam:7tm_1 39 288 3.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213496
Predicted Effect probably damaging
Transcript: ENSMUST00000213774
AA Change: T36A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000213865
AA Change: T36A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000214546
AA Change: T36A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000215682
AA Change: T36A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000218397
AA Change: T36A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A C 18: 58,954,619 I574L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
BC005624 T C 2: 30,974,008 E191G probably damaging Het
Cbx2 A G 11: 119,028,980 D457G probably damaging Het
Ccdc110 A G 8: 45,942,127 K352E probably benign Het
Cdk14 A T 5: 5,103,807 H183Q probably benign Het
Cfap58 A G 19: 47,941,339 T80A probably benign Het
Cftr C T 6: 18,226,106 T351I probably damaging Het
Col27a1 A G 4: 63,329,863 probably benign Het
Cp T A 3: 19,966,450 probably null Het
Cpne8 A T 15: 90,571,972 V196E probably benign Het
Dmxl1 T G 18: 49,859,286 probably null Het
Dnm2 T A 9: 21,504,458 L642Q probably damaging Het
Dock2 G T 11: 34,262,480 probably null Het
Dock9 A G 14: 121,543,574 F2091L possibly damaging Het
Eaf2 A G 16: 36,824,701 V53A probably damaging Het
Fam208b T C 13: 3,574,121 H1943R possibly damaging Het
Fbl G T 7: 28,174,787 probably benign Het
Fbn2 T C 18: 58,026,538 D2373G probably damaging Het
Gbp2b A G 3: 142,610,974 Y462C possibly damaging Het
Il1rl2 T A 1: 40,356,860 F348I probably benign Het
Khdc1a T A 1: 21,350,897 I102N possibly damaging Het
Klhl11 T C 11: 100,464,186 T270A probably benign Het
Lama1 T C 17: 67,805,428 S2288P probably benign Het
Lrfn4 T C 19: 4,613,495 E337G possibly damaging Het
Macf1 C A 4: 123,508,415 E549* probably null Het
Mmp3 G T 9: 7,447,641 V209F probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh9 G A 15: 77,764,401 R1725W probably damaging Het
Nbea A T 3: 56,002,891 D1294E possibly damaging Het
Nrcam G A 12: 44,563,986 A496T probably benign Het
Nufip2 A G 11: 77,693,008 T583A probably benign Het
Ppig C A 2: 69,735,873 T128K probably damaging Het
Ppp2r2a A T 14: 67,019,759 C341S possibly damaging Het
Ptpre A T 7: 135,669,799 D374V probably damaging Het
Ranbp3l A C 15: 9,064,988 Q485P probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Slc1a7 A G 4: 108,008,143 Y276C probably damaging Het
Smarcad1 A G 6: 65,067,107 D221G probably benign Het
Smn1 C A 13: 100,127,896 T45N probably damaging Het
Son T C 16: 91,657,622 S1086P probably damaging Het
Ssmem1 T A 6: 30,512,492 Y45N possibly damaging Het
Tmem184c A C 8: 77,602,922 F170V possibly damaging Het
Tmem184c A T 8: 77,606,162 probably null Het
Vmn1r59 C T 7: 5,454,467 C98Y probably damaging Het
Vmn2r23 T A 6: 123,713,427 S421T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Other mutations in Olfr1033
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:Olfr1033 APN 2 86042097 missense probably damaging 1.00
IGL01745:Olfr1033 APN 2 86042037 missense possibly damaging 0.74
IGL02317:Olfr1033 APN 2 86041569 missense probably damaging 0.99
IGL02400:Olfr1033 APN 2 86042076 missense probably benign 0.00
R0692:Olfr1033 UTSW 2 86042172 missense probably benign 0.00
R2105:Olfr1033 UTSW 2 86041330 missense probably damaging 0.97
R2288:Olfr1033 UTSW 2 86042033 nonsense probably null
R4451:Olfr1033 UTSW 2 86041959 missense probably damaging 1.00
R4512:Olfr1033 UTSW 2 86041569 missense probably damaging 0.99
R4878:Olfr1033 UTSW 2 86041455 missense probably benign 0.08
R5442:Olfr1033 UTSW 2 86041951 missense probably benign 0.29
R5867:Olfr1033 UTSW 2 86041451 missense probably benign 0.01
Z1088:Olfr1033 UTSW 2 86041719 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCCAAGAAATGTGGCTTATGTTCCC -3'
(R):5'- TTGTCTTTGACAGCAAGTTTTCCAGC -3'

Sequencing Primer
(F):5'- ttgggaggtagaggcagg -3'
(R):5'- CCAGCATTTTAGGAGTGACATTG -3'
Posted On2014-04-24