Incidental Mutation 'R1630:Sema6d'
ID172715
Institutional Source Beutler Lab
Gene Symbol Sema6d
Ensembl Gene ENSMUSG00000027200
Gene Namesema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
SynonymsSema6D-6, 1110067B02Rik, Sema6D-1, Sema6D-2, Sema6D-4, Sema6D-5
MMRRC Submission 039667-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1630 (G1)
Quality Score144
Status Validated
Chromosome2
Chromosomal Location124089969-124667770 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124664345 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 734 (D734G)
Ref Sequence ENSEMBL: ENSMUSP00000099528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051419] [ENSMUST00000076335] [ENSMUST00000077847] [ENSMUST00000078621] [ENSMUST00000103238] [ENSMUST00000103239] [ENSMUST00000103240] [ENSMUST00000103241]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051419
AA Change: D691G

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000061123
Gene: ENSMUSG00000027200
AA Change: D691G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 582 4.57e-1 SMART
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 743 764 N/A INTRINSIC
internal_repeat_1 797 898 7.43e-5 PROSPERO
internal_repeat_1 892 1004 7.43e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000076335
AA Change: D678G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075674
Gene: ENSMUSG00000027200
AA Change: D678G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
transmembrane domain 589 611 N/A INTRINSIC
low complexity region 730 751 N/A INTRINSIC
internal_repeat_1 784 885 7.28e-5 PROSPERO
internal_repeat_1 879 991 7.28e-5 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000077847
AA Change: D734G

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077014
Gene: ENSMUSG00000027200
AA Change: D734G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 573 584 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
low complexity region 786 807 N/A INTRINSIC
internal_repeat_1 840 941 5.95e-5 PROSPERO
internal_repeat_1 935 1047 5.95e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000078621
AA Change: D710G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000077691
Gene: ENSMUSG00000027200
AA Change: D710G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 582 4.57e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
low complexity region 762 783 N/A INTRINSIC
internal_repeat_1 816 917 8.83e-5 PROSPERO
internal_repeat_1 911 1023 8.83e-5 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000103238
AA Change: D734G

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099528
Gene: ENSMUSG00000027200
AA Change: D734G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 573 584 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
low complexity region 786 807 N/A INTRINSIC
internal_repeat_1 840 941 5.95e-5 PROSPERO
internal_repeat_1 935 1047 5.95e-5 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000103239
AA Change: D753G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099529
Gene: ENSMUSG00000027200
AA Change: D753G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 587 603 N/A INTRINSIC
transmembrane domain 664 686 N/A INTRINSIC
low complexity region 805 826 N/A INTRINSIC
internal_repeat_1 859 960 5.78e-5 PROSPERO
internal_repeat_1 954 1066 5.78e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000103240
AA Change: D749G

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099530
Gene: ENSMUSG00000027200
AA Change: D749G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 587 603 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
low complexity region 801 822 N/A INTRINSIC
internal_repeat_1 855 956 5.63e-5 PROSPERO
internal_repeat_1 950 1062 5.63e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000103241
AA Change: D678G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099531
Gene: ENSMUSG00000027200
AA Change: D678G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
transmembrane domain 589 611 N/A INTRINSIC
low complexity region 730 751 N/A INTRINSIC
internal_repeat_1 784 885 7.28e-5 PROSPERO
internal_repeat_1 879 991 7.28e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132088
Meta Mutation Damage Score 0.018 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Semaphorins are a large family, including both secreted and membrane associated proteins, many of which have been implicated as inhibitors or chemorepellents in axon pathfinding, fasciculation and branching, and target selection. All semaphorins possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Additional sequence motifs C-terminal to the semaphorin domain allow classification into distinct subfamilies. Results demonstrate that transmembrane semaphorins, like the secreted ones, can act as repulsive axon guidance cues. This gene encodes a class 6 vertebrate transmembrane semaphorin that demonstrates alternative splicing. Several transcript variants have been identified and expression of the distinct encoded isoforms is thought to be regulated in a tissue- and development-dependent manner. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal dendritic cell trafficking and antigen-specific T cell priming. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429P17Rik C A 13: 47,960,725 noncoding transcript Het
9930012K11Rik T C 14: 70,157,180 E175G probably benign Het
A630091E08Rik A G 7: 98,543,607 noncoding transcript Het
Atm A T 9: 53,479,673 L1867Q probably damaging Het
Atp5a1 A G 18: 77,777,567 D63G possibly damaging Het
Baz2b A T 2: 60,006,130 S20T unknown Het
C1qtnf7 G A 5: 43,609,161 C34Y possibly damaging Het
Cactin A G 10: 81,323,725 T353A probably benign Het
Cdyl A G 13: 35,683,803 K21E possibly damaging Het
Crispld1 A G 1: 17,728,798 T48A probably benign Het
Csmd3 T A 15: 47,838,522 T1722S possibly damaging Het
Dapk1 A T 13: 60,729,531 E528V probably damaging Het
Dennd4a A G 9: 64,871,882 D549G probably benign Het
Dnajc5b C A 3: 19,574,741 N66K probably damaging Het
Dusp16 G T 6: 134,720,561 R250S probably damaging Het
F10 A G 8: 13,055,551 N384S probably benign Het
Gabrr2 A G 4: 33,085,647 S331G probably damaging Het
Gm12185 A C 11: 48,907,890 I592S probably benign Het
Gm9755 T C 8: 67,514,660 noncoding transcript Het
Hspg2 T C 4: 137,518,435 L913P probably damaging Het
Ifna1 T A 4: 88,850,329 S81R probably benign Het
Iqgap2 T C 13: 95,689,785 K510E probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lhx6 A G 2: 36,102,901 Y140H probably damaging Het
Lix1 A G 17: 17,457,158 H205R probably damaging Het
Masp2 A T 4: 148,614,033 T524S probably benign Het
Mndal A C 1: 173,874,392 F115V possibly damaging Het
Morc3 C A 16: 93,866,533 N541K probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myocd A G 11: 65,196,394 S236P probably damaging Het
Nes T A 3: 87,977,677 V1037E probably benign Het
Nfkbil1 A G 17: 35,221,164 W178R probably damaging Het
Nobox A T 6: 43,307,212 C8* probably null Het
Nwd1 A G 8: 72,667,029 T348A possibly damaging Het
Olfr1048 A G 2: 86,236,086 S243P probably damaging Het
Olfr1350 T C 7: 6,570,674 S228P probably damaging Het
Olfr382 T C 11: 73,516,720 T160A probably damaging Het
Osbp2 T C 11: 3,717,167 T448A probably benign Het
Plrg1 A G 3: 83,058,763 D75G probably benign Het
Ppp1r8 T C 4: 132,829,437 E213G probably benign Het
Rad54l2 A G 9: 106,703,629 F898L possibly damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rasl10a G C 11: 5,059,542 R110P probably damaging Het
Rttn T C 18: 89,042,954 I1082T probably benign Het
Sgce C T 6: 4,719,476 V44M probably damaging Het
Sgo2b A G 8: 63,927,797 V667A possibly damaging Het
Shcbp1 A T 8: 4,748,763 C118* probably null Het
Slain2 C T 5: 72,976,004 P563S probably damaging Het
Slco1b2 A T 6: 141,656,821 I167F probably damaging Het
Speg T C 1: 75,422,977 L2356P probably damaging Het
Sptbn4 A G 7: 27,418,739 V305A probably benign Het
Sspo G A 6: 48,457,724 R1050H probably benign Het
Tmem106b A G 6: 13,081,541 N149S probably benign Het
Tmem200a T C 10: 25,992,914 T486A probably damaging Het
Tmem212 T A 3: 27,885,101 T79S possibly damaging Het
Ttll11 A G 2: 35,889,325 V471A probably damaging Het
Vill A G 9: 119,070,701 N318D probably benign Het
Vmn2r102 A G 17: 19,678,770 D458G possibly damaging Het
Zfp472 T A 17: 32,977,978 C342* probably null Het
Zfp963 A T 8: 69,744,187 probably benign Het
Other mutations in Sema6d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Sema6d APN 2 124659865 missense possibly damaging 0.91
IGL00508:Sema6d APN 2 124656924 splice site probably benign
IGL00710:Sema6d APN 2 124662288 missense probably benign 0.00
IGL00811:Sema6d APN 2 124658469 missense probably damaging 1.00
IGL01457:Sema6d APN 2 124653642 missense unknown
IGL01524:Sema6d APN 2 124664075 missense possibly damaging 0.86
IGL01598:Sema6d APN 2 124665098 missense probably damaging 1.00
IGL01915:Sema6d APN 2 124658571 splice site probably benign
IGL02365:Sema6d APN 2 124656868 missense probably benign 0.14
IGL02698:Sema6d APN 2 124653723 missense possibly damaging 0.95
IGL02865:Sema6d APN 2 124664073 missense probably damaging 1.00
IGL03018:Sema6d APN 2 124659600 missense possibly damaging 0.95
IGL03333:Sema6d APN 2 124664370 missense possibly damaging 0.83
R0269:Sema6d UTSW 2 124660745 missense possibly damaging 0.63
R0390:Sema6d UTSW 2 124658490 missense probably damaging 1.00
R0541:Sema6d UTSW 2 124665277 missense probably damaging 1.00
R0615:Sema6d UTSW 2 124654135 splice site probably benign
R0617:Sema6d UTSW 2 124660745 missense possibly damaging 0.63
R0694:Sema6d UTSW 2 124664041 missense probably damaging 1.00
R0854:Sema6d UTSW 2 124665302 missense probably damaging 0.97
R1682:Sema6d UTSW 2 124665149 missense probably benign 0.21
R1823:Sema6d UTSW 2 124659556 splice site probably null
R1932:Sema6d UTSW 2 124659886 critical splice donor site probably null
R2249:Sema6d UTSW 2 124659588 missense possibly damaging 0.54
R2256:Sema6d UTSW 2 124664150 missense probably damaging 1.00
R2331:Sema6d UTSW 2 124658063 missense probably damaging 1.00
R2910:Sema6d UTSW 2 124665037 missense probably damaging 1.00
R3683:Sema6d UTSW 2 124654226 missense possibly damaging 0.88
R3937:Sema6d UTSW 2 124656850 missense probably benign 0.00
R4135:Sema6d UTSW 2 124664120 missense probably damaging 0.96
R4446:Sema6d UTSW 2 124664059 missense probably damaging 0.98
R4583:Sema6d UTSW 2 124664162 missense probably damaging 1.00
R4599:Sema6d UTSW 2 124654231 missense probably damaging 1.00
R4822:Sema6d UTSW 2 124662294 missense possibly damaging 0.79
R4884:Sema6d UTSW 2 124656818 splice site probably null
R5288:Sema6d UTSW 2 124664246 missense probably damaging 1.00
R5443:Sema6d UTSW 2 124656836 missense probably damaging 1.00
R5504:Sema6d UTSW 2 124658021 missense probably damaging 1.00
R5534:Sema6d UTSW 2 124659815 missense possibly damaging 0.75
R5615:Sema6d UTSW 2 124656901 missense probably damaging 0.97
R5747:Sema6d UTSW 2 124664947 missense probably damaging 0.99
R5866:Sema6d UTSW 2 124664342 missense probably benign 0.26
R5980:Sema6d UTSW 2 124664708 missense probably damaging 1.00
R6670:Sema6d UTSW 2 124654842 small deletion probably benign
R6803:Sema6d UTSW 2 124664050 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAAGCCTTCCCGTGTCTGTTGC -3'
(R):5'- GGGTGTTCTTTCCTTGAAGCACCG -3'

Sequencing Primer
(F):5'- AGATGGTCCACATGAATGTCCTC -3'
(R):5'- GTGGCTGTGGGCCTTCTC -3'
Posted On2014-04-24