Incidental Mutation 'R1632:Phf19'
ID172828
Institutional Source Beutler Lab
Gene Symbol Phf19
Ensembl Gene ENSMUSG00000026873
Gene NamePHD finger protein 19
Synonyms
MMRRC Submission 039669-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.441) question?
Stock #R1632 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location34893757-34914026 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34911619 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 60 (R60W)
Ref Sequence ENSEMBL: ENSMUSP00000143954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028232] [ENSMUST00000202907]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028232
AA Change: R60W

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028232
Gene: ENSMUSG00000026873
AA Change: R60W

DomainStartEndE-ValueType
TUDOR 36 93 2.33e-8 SMART
PHD 96 147 2.87e-5 SMART
low complexity region 154 165 N/A INTRINSIC
PHD 195 245 2.11e-3 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 442 464 N/A INTRINSIC
Pfam:Mtf2_C 529 576 5.2e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158129
Predicted Effect probably damaging
Transcript: ENSMUST00000202907
AA Change: R60W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143954
Gene: ENSMUSG00000026873
AA Change: R60W

DomainStartEndE-ValueType
TUDOR 36 88 2.8e-7 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T C 9: 51,290,402 D118G probably damaging Het
AF529169 T A 9: 89,602,360 H328L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap28 A T 17: 67,849,074 Y696N probably damaging Het
C77080 A G 4: 129,222,666 M735T possibly damaging Het
Cachd1 A G 4: 100,966,972 T537A probably benign Het
Capn15 A T 17: 25,960,665 F841Y probably damaging Het
Card10 G A 15: 78,791,220 R396* probably null Het
Chd9 A T 8: 90,956,707 K592* probably null Het
Cyp2j8 T A 4: 96,447,324 H411L probably benign Het
Dhcr24 G T 4: 106,585,951 M394I probably benign Het
Dhrs3 T C 4: 144,893,546 V11A probably benign Het
Dync1li2 A T 8: 104,437,491 I134N probably damaging Het
Enpp4 G T 17: 44,099,653 S344Y probably damaging Het
Ephb3 T C 16: 21,212,937 S14P probably benign Het
Fancm T G 12: 65,130,331 I1983S probably damaging Het
Fndc1 T C 17: 7,773,200 T555A unknown Het
Gemin4 A T 11: 76,210,989 M982K probably benign Het
Gtpbp2 A G 17: 46,168,592 R590G probably benign Het
H2-M3 G A 17: 37,271,163 R170H probably benign Het
Hoxa13 G T 6: 52,259,937 N278K probably damaging Het
Hspb3 A G 13: 113,663,053 V147A probably benign Het
Il6st G T 13: 112,504,332 D820Y possibly damaging Het
Kdm7a A G 6: 39,152,898 V448A probably benign Het
Kmt2b T C 7: 30,583,962 D991G probably damaging Het
Kri1 T C 9: 21,282,211 D140G possibly damaging Het
Limk2 A G 11: 3,346,250 L399P probably damaging Het
Lrrc9 T A 12: 72,460,020 probably null Het
Map2 C T 1: 66,415,086 T1045M possibly damaging Het
Map4k5 T C 12: 69,828,047 I321V probably benign Het
Mpp5 T A 12: 78,797,038 Y5* probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh7b A G 2: 155,620,525 S383G probably benign Het
Nostrin A G 2: 69,175,734 K254R probably benign Het
Nphp1 G T 2: 127,770,392 P212T probably benign Het
Olfr988 A T 2: 85,353,242 M228K possibly damaging Het
Pclo A C 5: 14,680,003 probably benign Het
Psg18 G A 7: 18,350,899 P91S probably benign Het
Rttn C T 18: 89,009,336 T525I probably benign Het
Ryr1 T C 7: 29,094,261 M1268V probably benign Het
Slc25a2 T C 18: 37,637,687 E263G possibly damaging Het
Slc32a1 C T 2: 158,613,890 A155V possibly damaging Het
Slc6a19 A T 13: 73,689,908 probably null Het
Socs4 A G 14: 47,289,577 probably benign Het
Tas2r118 A G 6: 23,969,261 I267T probably benign Het
Tpte G A 8: 22,349,347 C470Y probably damaging Het
Usp17la A T 7: 104,860,911 H241L probably benign Het
Vmn2r72 T A 7: 85,751,792 I140F probably benign Het
Zfp329 T C 7: 12,810,949 D216G possibly damaging Het
Other mutations in Phf19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Phf19 APN 2 34897107 missense probably damaging 0.99
IGL01862:Phf19 APN 2 34897055 critical splice donor site probably null
R0079:Phf19 UTSW 2 34895954 missense probably benign
R0183:Phf19 UTSW 2 34911202 missense probably damaging 1.00
R1289:Phf19 UTSW 2 34896030 missense probably benign
R1829:Phf19 UTSW 2 34911769 missense probably benign 0.00
R2057:Phf19 UTSW 2 34899608 missense probably benign 0.06
R2475:Phf19 UTSW 2 34895795 missense probably benign
R3039:Phf19 UTSW 2 34905522 missense probably benign 0.26
R3803:Phf19 UTSW 2 34899658 missense probably damaging 0.99
R3804:Phf19 UTSW 2 34899658 missense probably damaging 0.99
R4885:Phf19 UTSW 2 34899706 missense probably damaging 0.99
R5759:Phf19 UTSW 2 34897123 missense probably damaging 1.00
R6061:Phf19 UTSW 2 34897117 missense probably damaging 1.00
R6949:Phf19 UTSW 2 34904131 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGAACAGGGGCACCACTTAATG -3'
(R):5'- CCGATGTCAGCAGAAGCTAATGGAG -3'

Sequencing Primer
(F):5'- AGGCCAGAGAGTCTTCTGTACC -3'
(R):5'- CTAATGGAGACTCAAGCTCTGG -3'
Posted On2014-04-24