Incidental Mutation 'R1632:Alkbh2'
ID172842
Institutional Source Beutler Lab
Gene Symbol Alkbh2
Ensembl Gene ENSMUSG00000044339
Gene NamealkB homolog 2, alpha-ketoglutarate-dependent dioxygenase
SynonymsAbh2, mABH2
MMRRC Submission 039669-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1632 (G1)
Quality Score194
Status Not validated
Chromosome5
Chromosomal Location114123926-114128218 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 114124226 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 148 (E148K)
Ref Sequence ENSEMBL: ENSMUSP00000107898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031588] [ENSMUST00000053657] [ENSMUST00000112279] [ENSMUST00000149418] [ENSMUST00000200119]
Predicted Effect probably benign
Transcript: ENSMUST00000031588
SMART Domains Protein: ENSMUSP00000031588
Gene: ENSMUSG00000029592

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
Pfam:UCH 67 499 2.6e-44 PFAM
Pfam:UCH_1 68 481 8.8e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000053657
AA Change: E148K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056043
Gene: ENSMUSG00000044339
AA Change: E148K

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:2OG-FeII_Oxy_2 47 232 1.9e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112279
AA Change: E148K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107898
Gene: ENSMUSG00000044339
AA Change: E148K

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:2OG-FeII_Oxy_2 47 232 5.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149418
Predicted Effect probably benign
Transcript: ENSMUST00000200119
SMART Domains Protein: ENSMUSP00000142350
Gene: ENSMUSG00000029592

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
Pfam:UCH 67 368 2.9e-31 PFAM
Pfam:UCH_1 68 376 1e-14 PFAM
Meta Mutation Damage Score 0.268 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Escherichia coli AlkB protein protects against the cytotoxicity of methylating agents by repair of the specific DNA lesions generated in single-stranded DNA. ALKBH2 and ALKBH3 (MIM 610603) are E. coli AlkB homologs that catalyze the removal of 1-methyladenine and 3-methylcytosine (Duncan et al., 2002 [PubMed 12486230]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice are viable and overtly normal but show progressive accumulation of 1-methyladenine (1meA) in their genomic DNA due to impaired DNA repair. Mutant MEFs fail to remove methyl methane sulfate (MMS)-induced 1meA from genomic DNA and showincreased cytotoxicity after MMS exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T C 9: 51,290,402 D118G probably damaging Het
AF529169 T A 9: 89,602,360 H328L probably damaging Het
Arhgap28 A T 17: 67,849,074 Y696N probably damaging Het
C77080 A G 4: 129,222,666 M735T possibly damaging Het
Cachd1 A G 4: 100,966,972 T537A probably benign Het
Capn15 A T 17: 25,960,665 F841Y probably damaging Het
Card10 G A 15: 78,791,220 R396* probably null Het
Chd9 A T 8: 90,956,707 K592* probably null Het
Cyp2j8 T A 4: 96,447,324 H411L probably benign Het
Dhcr24 G T 4: 106,585,951 M394I probably benign Het
Dhrs3 T C 4: 144,893,546 V11A probably benign Het
Dync1li2 A T 8: 104,437,491 I134N probably damaging Het
Enpp4 G T 17: 44,099,653 S344Y probably damaging Het
Ephb3 T C 16: 21,212,937 S14P probably benign Het
Fancm T G 12: 65,130,331 I1983S probably damaging Het
Fndc1 T C 17: 7,773,200 T555A unknown Het
Gemin4 A T 11: 76,210,989 M982K probably benign Het
Gtpbp2 A G 17: 46,168,592 R590G probably benign Het
H2-M3 G A 17: 37,271,163 R170H probably benign Het
Hoxa13 G T 6: 52,259,937 N278K probably damaging Het
Hspb3 A G 13: 113,663,053 V147A probably benign Het
Il6st G T 13: 112,504,332 D820Y possibly damaging Het
Kdm7a A G 6: 39,152,898 V448A probably benign Het
Kmt2b T C 7: 30,583,962 D991G probably damaging Het
Kri1 T C 9: 21,282,211 D140G possibly damaging Het
Limk2 A G 11: 3,346,250 L399P probably damaging Het
Lrrc9 T A 12: 72,460,020 probably null Het
Map2 C T 1: 66,415,086 T1045M possibly damaging Het
Map4k5 T C 12: 69,828,047 I321V probably benign Het
Mpp5 T A 12: 78,797,038 Y5* probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh7b A G 2: 155,620,525 S383G probably benign Het
Nostrin A G 2: 69,175,734 K254R probably benign Het
Nphp1 G T 2: 127,770,392 P212T probably benign Het
Olfr988 A T 2: 85,353,242 M228K possibly damaging Het
Pclo A C 5: 14,680,003 probably benign Het
Phf19 G A 2: 34,911,619 R60W probably damaging Het
Psg18 G A 7: 18,350,899 P91S probably benign Het
Rttn C T 18: 89,009,336 T525I probably benign Het
Ryr1 T C 7: 29,094,261 M1268V probably benign Het
Slc25a2 T C 18: 37,637,687 E263G possibly damaging Het
Slc32a1 C T 2: 158,613,890 A155V possibly damaging Het
Slc6a19 A T 13: 73,689,908 probably null Het
Socs4 A G 14: 47,289,577 probably benign Het
Tas2r118 A G 6: 23,969,261 I267T probably benign Het
Tpte G A 8: 22,349,347 C470Y probably damaging Het
Usp17la A T 7: 104,860,911 H241L probably benign Het
Vmn2r72 T A 7: 85,751,792 I140F probably benign Het
Zfp329 T C 7: 12,810,949 D216G possibly damaging Het
Other mutations in Alkbh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02298:Alkbh2 APN 5 114125572 missense probably benign
R0326:Alkbh2 UTSW 5 114123950 makesense probably null
R0480:Alkbh2 UTSW 5 114125535 missense probably damaging 1.00
R0962:Alkbh2 UTSW 5 114123953 missense possibly damaging 0.94
R1214:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1215:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1280:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1282:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1309:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1340:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1371:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1443:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1445:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1545:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1546:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1629:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1631:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1707:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1769:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1920:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1921:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1922:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1984:Alkbh2 UTSW 5 114124054 missense probably benign 0.12
R2140:Alkbh2 UTSW 5 114125716 missense probably benign 0.03
R2142:Alkbh2 UTSW 5 114125716 missense probably benign 0.03
R3800:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R3981:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4032:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4062:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4064:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4163:Alkbh2 UTSW 5 114127552 missense probably damaging 1.00
R4569:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4570:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4624:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4625:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4626:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4627:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4628:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4630:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4632:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4633:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4801:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4802:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4803:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCATCATCAGCAGGCTTCCGTG -3'
(R):5'- CTGTGAACCTGGAAGGCGTAGC -3'

Sequencing Primer
(F):5'- AGGCTTCCGTGTGCCAG -3'
(R):5'- acacagacagacagacagac -3'
Posted On2014-04-24