Incidental Mutation 'R1632:Mpp5'
ID172866
Institutional Source Beutler Lab
Gene Symbol Mpp5
Ensembl Gene ENSMUSG00000021112
Gene Namemembrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)
SynonymsPals1, 3830420B02Rik
MMRRC Submission 039669-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.732) question?
Stock #R1632 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location78748907-78840714 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 78797038 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 5 (Y5*)
Ref Sequence ENSEMBL: ENSMUSP00000151349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082024] [ENSMUST00000219197] [ENSMUST00000219667]
Predicted Effect probably null
Transcript: ENSMUST00000082024
AA Change: Y5*
SMART Domains Protein: ENSMUSP00000080683
Gene: ENSMUSG00000021112
AA Change: Y5*

DomainStartEndE-ValueType
coiled coil region 54 76 N/A INTRINSIC
L27 123 180 2.04e-10 SMART
L27 186 238 7.39e-8 SMART
PDZ 265 336 5.99e-13 SMART
SH3 348 416 1.2e-10 SMART
low complexity region 439 454 N/A INTRINSIC
GuKc 478 663 1.72e-64 SMART
Predicted Effect probably null
Transcript: ENSMUST00000219197
AA Change: Y5*
Predicted Effect probably benign
Transcript: ENSMUST00000219667
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the p55-like subfamily of the membrane-associated guanylate kinase (MAGUK) gene superfamily. The encoded protein participates in the polarization of differentiating cells, has been shown to regulate myelinating Schwann cells (PMID: 20237282), and is one of the components of the Crumbs complex in the retina. Mice which express lower levels of the orthologous protein have retinal degeneration and impaired vision (PMID: 22114289). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a floxed allele activated in cortical neuron exhibit loss of cortex neurons due to premature differentiation and increased apoptosis. These mice also exhibit behavioral defects but are otherwise viable and fertile. Heterozygous mice exhibit an intermediate phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T C 9: 51,290,402 D118G probably damaging Het
AF529169 T A 9: 89,602,360 H328L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap28 A T 17: 67,849,074 Y696N probably damaging Het
C77080 A G 4: 129,222,666 M735T possibly damaging Het
Cachd1 A G 4: 100,966,972 T537A probably benign Het
Capn15 A T 17: 25,960,665 F841Y probably damaging Het
Card10 G A 15: 78,791,220 R396* probably null Het
Chd9 A T 8: 90,956,707 K592* probably null Het
Cyp2j8 T A 4: 96,447,324 H411L probably benign Het
Dhcr24 G T 4: 106,585,951 M394I probably benign Het
Dhrs3 T C 4: 144,893,546 V11A probably benign Het
Dync1li2 A T 8: 104,437,491 I134N probably damaging Het
Enpp4 G T 17: 44,099,653 S344Y probably damaging Het
Ephb3 T C 16: 21,212,937 S14P probably benign Het
Fancm T G 12: 65,130,331 I1983S probably damaging Het
Fndc1 T C 17: 7,773,200 T555A unknown Het
Gemin4 A T 11: 76,210,989 M982K probably benign Het
Gtpbp2 A G 17: 46,168,592 R590G probably benign Het
H2-M3 G A 17: 37,271,163 R170H probably benign Het
Hoxa13 G T 6: 52,259,937 N278K probably damaging Het
Hspb3 A G 13: 113,663,053 V147A probably benign Het
Il6st G T 13: 112,504,332 D820Y possibly damaging Het
Kdm7a A G 6: 39,152,898 V448A probably benign Het
Kmt2b T C 7: 30,583,962 D991G probably damaging Het
Kri1 T C 9: 21,282,211 D140G possibly damaging Het
Limk2 A G 11: 3,346,250 L399P probably damaging Het
Lrrc9 T A 12: 72,460,020 probably null Het
Map2 C T 1: 66,415,086 T1045M possibly damaging Het
Map4k5 T C 12: 69,828,047 I321V probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh7b A G 2: 155,620,525 S383G probably benign Het
Nostrin A G 2: 69,175,734 K254R probably benign Het
Nphp1 G T 2: 127,770,392 P212T probably benign Het
Olfr988 A T 2: 85,353,242 M228K possibly damaging Het
Pclo A C 5: 14,680,003 probably benign Het
Phf19 G A 2: 34,911,619 R60W probably damaging Het
Psg18 G A 7: 18,350,899 P91S probably benign Het
Rttn C T 18: 89,009,336 T525I probably benign Het
Ryr1 T C 7: 29,094,261 M1268V probably benign Het
Slc25a2 T C 18: 37,637,687 E263G possibly damaging Het
Slc32a1 C T 2: 158,613,890 A155V possibly damaging Het
Slc6a19 A T 13: 73,689,908 probably null Het
Socs4 A G 14: 47,289,577 probably benign Het
Tas2r118 A G 6: 23,969,261 I267T probably benign Het
Tpte G A 8: 22,349,347 C470Y probably damaging Het
Usp17la A T 7: 104,860,911 H241L probably benign Het
Vmn2r72 T A 7: 85,751,792 I140F probably benign Het
Zfp329 T C 7: 12,810,949 D216G possibly damaging Het
Other mutations in Mpp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Mpp5 APN 12 78829799 missense possibly damaging 0.89
IGL00863:Mpp5 APN 12 78809821 missense probably damaging 1.00
IGL01860:Mpp5 APN 12 78830907 missense possibly damaging 0.79
R1584:Mpp5 UTSW 12 78829727 missense probably benign 0.34
R2117:Mpp5 UTSW 12 78809922 missense possibly damaging 0.81
R2186:Mpp5 UTSW 12 78819371 splice site probably benign
R2211:Mpp5 UTSW 12 78797248 missense possibly damaging 0.78
R4044:Mpp5 UTSW 12 78824839 missense probably benign 0.06
R4224:Mpp5 UTSW 12 78829718 missense probably damaging 1.00
R4535:Mpp5 UTSW 12 78824837 missense possibly damaging 0.90
R5157:Mpp5 UTSW 12 78820815 missense possibly damaging 0.95
R6144:Mpp5 UTSW 12 78824789 missense possibly damaging 0.75
R6180:Mpp5 UTSW 12 78817310 missense probably benign 0.11
R7037:Mpp5 UTSW 12 78797199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGGCTTGTGCTATGCACCAG -3'
(R):5'- TGTTGTCGAATCCGCTCTAACTGTG -3'

Sequencing Primer
(F):5'- TGAAAGGAGTGACCTTACTCTG -3'
(R):5'- TGCACTTCTTCGCACTGG -3'
Posted On2014-04-24