Incidental Mutation 'R1632:H2-M3'
ID172880
Institutional Source Beutler Lab
Gene Symbol H2-M3
Ensembl Gene ENSMUSG00000016206
Gene Namehistocompatibility 2, M region locus 3
SynonymsH-2M3, Hmt, R4B2
MMRRC Submission 039669-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1632 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37270220-37274484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37271163 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 170 (R170H)
Ref Sequence ENSEMBL: ENSMUSP00000035687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038580]
PDB Structure
MODEL OF MHC CLASS I H2-M3 WITH NONAPEPTIDE FROM RAT ND1 REFINED AT 2.3 ANGSTROMS RESOLUTION [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000038580
AA Change: R170H

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000035687
Gene: ENSMUSG00000016206
AA Change: R170H

DomainStartEndE-ValueType
Pfam:MHC_I 25 203 6.6e-76 PFAM
IGc1 222 293 4.91e-21 SMART
transmembrane domain 306 328 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122476
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-G belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. HLA-G is expressed on fetal derived placental cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the alpha1 and alpha2 domain, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region, and exon 6 encodes the cytoplasmic tail. [provided by RefSeq, Jul 2008]
PHENOTYPE: At least three alleles are known for this locus: allele a, found in C57BL/6, C3H-Pgk1a, NZO and NMRI, and allele c, found in M. spretus determine distinct antigen specificities. Allele b, found in M.m. castaneus results in absence of antigen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T C 9: 51,290,402 D118G probably damaging Het
AF529169 T A 9: 89,602,360 H328L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap28 A T 17: 67,849,074 Y696N probably damaging Het
C77080 A G 4: 129,222,666 M735T possibly damaging Het
Cachd1 A G 4: 100,966,972 T537A probably benign Het
Capn15 A T 17: 25,960,665 F841Y probably damaging Het
Card10 G A 15: 78,791,220 R396* probably null Het
Chd9 A T 8: 90,956,707 K592* probably null Het
Cyp2j8 T A 4: 96,447,324 H411L probably benign Het
Dhcr24 G T 4: 106,585,951 M394I probably benign Het
Dhrs3 T C 4: 144,893,546 V11A probably benign Het
Dync1li2 A T 8: 104,437,491 I134N probably damaging Het
Enpp4 G T 17: 44,099,653 S344Y probably damaging Het
Ephb3 T C 16: 21,212,937 S14P probably benign Het
Fancm T G 12: 65,130,331 I1983S probably damaging Het
Fndc1 T C 17: 7,773,200 T555A unknown Het
Gemin4 A T 11: 76,210,989 M982K probably benign Het
Gtpbp2 A G 17: 46,168,592 R590G probably benign Het
Hoxa13 G T 6: 52,259,937 N278K probably damaging Het
Hspb3 A G 13: 113,663,053 V147A probably benign Het
Il6st G T 13: 112,504,332 D820Y possibly damaging Het
Kdm7a A G 6: 39,152,898 V448A probably benign Het
Kmt2b T C 7: 30,583,962 D991G probably damaging Het
Kri1 T C 9: 21,282,211 D140G possibly damaging Het
Limk2 A G 11: 3,346,250 L399P probably damaging Het
Lrrc9 T A 12: 72,460,020 probably null Het
Map2 C T 1: 66,415,086 T1045M possibly damaging Het
Map4k5 T C 12: 69,828,047 I321V probably benign Het
Mpp5 T A 12: 78,797,038 Y5* probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh7b A G 2: 155,620,525 S383G probably benign Het
Nostrin A G 2: 69,175,734 K254R probably benign Het
Nphp1 G T 2: 127,770,392 P212T probably benign Het
Olfr988 A T 2: 85,353,242 M228K possibly damaging Het
Pclo A C 5: 14,680,003 probably benign Het
Phf19 G A 2: 34,911,619 R60W probably damaging Het
Psg18 G A 7: 18,350,899 P91S probably benign Het
Rttn C T 18: 89,009,336 T525I probably benign Het
Ryr1 T C 7: 29,094,261 M1268V probably benign Het
Slc25a2 T C 18: 37,637,687 E263G possibly damaging Het
Slc32a1 C T 2: 158,613,890 A155V possibly damaging Het
Slc6a19 A T 13: 73,689,908 probably null Het
Socs4 A G 14: 47,289,577 probably benign Het
Tas2r118 A G 6: 23,969,261 I267T probably benign Het
Tpte G A 8: 22,349,347 C470Y probably damaging Het
Usp17la A T 7: 104,860,911 H241L probably benign Het
Vmn2r72 T A 7: 85,751,792 I140F probably benign Het
Zfp329 T C 7: 12,810,949 D216G possibly damaging Het
Other mutations in H2-M3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:H2-M3 APN 17 37270657 missense possibly damaging 0.89
IGL01891:H2-M3 APN 17 37272717 missense probably benign 0.23
IGL02689:H2-M3 APN 17 37270541 nonsense probably null
IGL02755:H2-M3 APN 17 37271022 missense possibly damaging 0.81
IGL02994:H2-M3 APN 17 37270738 missense probably benign
IGL03135:H2-M3 APN 17 37272433 missense possibly damaging 0.90
IGL03177:H2-M3 APN 17 37270316 missense possibly damaging 0.86
R1328:H2-M3 UTSW 17 37271034 missense possibly damaging 0.71
R1919:H2-M3 UTSW 17 37271189 missense possibly damaging 0.67
R3981:H2-M3 UTSW 17 37271130 missense probably damaging 0.97
R4304:H2-M3 UTSW 17 37272404 missense probably benign 0.07
R4620:H2-M3 UTSW 17 37272419 missense probably damaging 0.97
R5765:H2-M3 UTSW 17 37272443 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTGTTTGTGGCTAGGCTCTCACATC -3'
(R):5'- TGTTGGATCAGGAAGGCCAGTACC -3'

Sequencing Primer
(F):5'- TGGCTCAGATTACATCACCC -3'
(R):5'- GACATCAAGAGCCTCACTTGTATG -3'
Posted On2014-04-24