Incidental Mutation 'R1633:Tmem63a'
ID172893
Institutional Source Beutler Lab
Gene Symbol Tmem63a
Ensembl Gene ENSMUSG00000026519
Gene Nametransmembrane protein 63a
Synonyms
MMRRC Submission 039670-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R1633 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location180942344-180975112 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 180948826 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 67 (V67E)
Ref Sequence ENSEMBL: ENSMUSP00000124937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027800] [ENSMUST00000159436] [ENSMUST00000160508] [ENSMUST00000160536] [ENSMUST00000161523] [ENSMUST00000161847] [ENSMUST00000162283]
Predicted Effect probably benign
Transcript: ENSMUST00000027800
AA Change: V67E

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027800
Gene: ENSMUSG00000026519
AA Change: V67E

DomainStartEndE-ValueType
Pfam:RSN1_TM 50 213 3.3e-24 PFAM
Pfam:PHM7_cyt 261 327 8.2e-12 PFAM
Pfam:RSN1_7TM 349 692 1.5e-87 PFAM
transmembrane domain 697 719 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128545
Predicted Effect possibly damaging
Transcript: ENSMUST00000159436
AA Change: V67E

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125192
Gene: ENSMUSG00000026519
AA Change: V67E

DomainStartEndE-ValueType
Pfam:RSN1_TM 50 173 2.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160508
Predicted Effect possibly damaging
Transcript: ENSMUST00000160536
AA Change: V67E

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124860
Gene: ENSMUSG00000026519
AA Change: V67E

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161523
AA Change: V67E

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124021
Gene: ENSMUSG00000026519
AA Change: V67E

DomainStartEndE-ValueType
Pfam:RSN1_TM 50 213 3.6e-25 PFAM
Pfam:DUF4463 261 326 9.4e-15 PFAM
Pfam:DUF221 349 692 1.4e-87 PFAM
transmembrane domain 697 719 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161847
AA Change: V67E

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124937
Gene: ENSMUSG00000026519
AA Change: V67E

DomainStartEndE-ValueType
transmembrane domain 49 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162283
Meta Mutation Damage Score 0.248 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.9%
  • 20x: 83.9%
Validation Efficiency 94% (68/72)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd C T 1: 127,753,855 A185V probably benign Het
Acsl6 T C 11: 54,328,398 probably benign Het
Arel1 A G 12: 84,926,283 F580S probably damaging Het
Arhgef19 T C 4: 141,238,560 probably benign Het
Bpifb3 T A 2: 153,922,584 L132Q probably damaging Het
Cacna2d1 T A 5: 16,320,116 D516E probably damaging Het
Ccar1 T C 10: 62,751,014 R882G unknown Het
Cep162 T C 9: 87,203,683 E1196G probably benign Het
Cpt1b T C 15: 89,418,815 T649A probably damaging Het
Cttnbp2 A T 6: 18,435,167 S231T probably damaging Het
Dgcr14 A G 16: 17,909,967 V116A probably benign Het
Dock8 A G 19: 25,051,563 T44A probably benign Het
Edrf1 T C 7: 133,652,140 S536P probably damaging Het
Eif5 T A 12: 111,540,287 N104K probably damaging Het
Enpp3 T C 10: 24,795,782 Y438C probably damaging Het
Fam208b A T 13: 3,581,771 I910N possibly damaging Het
Galnt4 T C 10: 99,109,952 V513A possibly damaging Het
Gdpd5 T C 7: 99,448,513 I172T probably benign Het
Ggt7 C T 2: 155,502,688 G245D probably damaging Het
Gm5884 A T 6: 128,646,065 noncoding transcript Het
Herc2 G A 7: 56,229,369 G4669R probably null Het
Hydin T A 8: 110,506,982 D1817E probably benign Het
Igf2r A C 17: 12,726,309 N359K probably benign Het
Itgb4 T C 11: 116,007,760 F1722L probably damaging Het
Itih3 T A 14: 30,917,398 E406V possibly damaging Het
Lamc2 A T 1: 153,141,698 C514* probably null Het
Mepe G T 5: 104,337,674 V227F probably benign Het
Nadk C T 4: 155,577,185 T56I probably damaging Het
Nedd4 G A 9: 72,671,257 V84I possibly damaging Het
Nipal3 C A 4: 135,447,348 R364L probably benign Het
Nkx2-9 T C 12: 56,612,981 R27G probably benign Het
Noc2l T A 4: 156,245,293 S600T probably benign Het
Olfr15 A C 16: 3,839,532 K186N probably damaging Het
Olfr364-ps1 T A 2: 37,146,971 I253N probably damaging Het
Olfr98 T A 17: 37,263,662 M1L probably benign Het
Pax6 A T 2: 105,691,718 E240V probably damaging Het
Pdilt T G 7: 119,487,994 T478P probably damaging Het
Phldb1 T A 9: 44,718,322 I25F probably damaging Het
Rad50 C T 11: 53,692,859 R365Q probably benign Het
Rdh10 A G 1: 16,128,196 E186G possibly damaging Het
Rdh12 A T 12: 79,218,724 E224V probably damaging Het
Reck T C 4: 43,922,964 V413A possibly damaging Het
Scn8a A G 15: 101,029,815 I1392V probably benign Het
Simc1 G A 13: 54,525,231 G464D probably benign Het
Srf A T 17: 46,551,608 V318E probably damaging Het
Stab1 T C 14: 31,150,380 probably null Het
Stk3 T C 15: 34,959,060 D322G probably damaging Het
Stxbp4 A G 11: 90,540,160 probably benign Het
Sult2a1 A G 7: 13,801,426 I234T probably benign Het
Syne1 A G 10: 5,349,388 F956L probably damaging Het
Thsd7a G T 6: 12,471,104 S505* probably null Het
Tram2 A T 1: 21,003,922 V264E probably damaging Het
Trpv5 A T 6: 41,675,920 C106* probably null Het
Tspyl5 T A 15: 33,686,645 K385* probably null Het
Vezt T A 10: 93,984,276 Q409L probably damaging Het
Vmn2r79 T C 7: 87,037,834 C808R possibly damaging Het
Wdfy3 A C 5: 101,981,548 V4G probably damaging Het
Wdr95 A T 5: 149,593,172 I493F probably damaging Het
Zfhx4 A T 3: 5,400,413 N1877I probably damaging Het
Zfp180 A G 7: 24,104,801 D215G probably benign Het
Zfp442 A T 2: 150,408,340 Y490* probably null Het
Zfp804b A G 5: 7,179,513 probably benign Het
Other mutations in Tmem63a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Tmem63a APN 1 180963088 missense probably damaging 1.00
IGL00331:Tmem63a APN 1 180966497 missense possibly damaging 0.46
IGL01116:Tmem63a APN 1 180972089 missense probably damaging 0.96
IGL01368:Tmem63a APN 1 180970232 missense possibly damaging 0.69
IGL01445:Tmem63a APN 1 180946631 missense probably damaging 1.00
IGL01867:Tmem63a APN 1 180956005 missense possibly damaging 0.87
IGL02043:Tmem63a APN 1 180972788 missense probably benign 0.11
IGL02453:Tmem63a APN 1 180963069 missense probably benign 0.02
IGL02527:Tmem63a APN 1 180952974 splice site probably null
IGL02811:Tmem63a APN 1 180965783 missense probably damaging 0.99
IGL02975:Tmem63a APN 1 180961075 missense probably benign
IGL03304:Tmem63a APN 1 180968853 nonsense probably null
R0029:Tmem63a UTSW 1 180962466 missense probably benign 0.01
R0029:Tmem63a UTSW 1 180962466 missense probably benign 0.01
R0173:Tmem63a UTSW 1 180954798 splice site probably benign
R0358:Tmem63a UTSW 1 180956423 missense probably benign 0.17
R0436:Tmem63a UTSW 1 180972733 missense probably benign 0.03
R0506:Tmem63a UTSW 1 180958049 critical splice donor site probably null
R0513:Tmem63a UTSW 1 180960461 missense probably benign 0.00
R0529:Tmem63a UTSW 1 180961094 missense probably benign 0.09
R0855:Tmem63a UTSW 1 180961060 missense possibly damaging 0.82
R2129:Tmem63a UTSW 1 180965540 missense probably benign 0.00
R2212:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R2214:Tmem63a UTSW 1 180961114 missense probably benign 0.00
R2413:Tmem63a UTSW 1 180961075 missense probably benign
R2437:Tmem63a UTSW 1 180962489 splice site probably null
R3703:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3704:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3705:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3714:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3746:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3747:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3961:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3963:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R4675:Tmem63a UTSW 1 180956491 missense probably benign 0.00
R4795:Tmem63a UTSW 1 180954851 missense probably damaging 1.00
R4876:Tmem63a UTSW 1 180973186 missense probably benign
R4916:Tmem63a UTSW 1 180966521 missense probably benign 0.36
R4917:Tmem63a UTSW 1 180966521 missense probably benign 0.36
R4918:Tmem63a UTSW 1 180966521 missense probably benign 0.36
R5620:Tmem63a UTSW 1 180970246 missense probably benign 0.00
R5843:Tmem63a UTSW 1 180972833 critical splice donor site probably null
R5937:Tmem63a UTSW 1 180961151 missense probably damaging 1.00
R6823:Tmem63a UTSW 1 180960470 missense possibly damaging 0.60
R6990:Tmem63a UTSW 1 180961121 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGAAAGACTCCATCCAAGCCTGAGG -3'
(R):5'- GTGAATACAGCTCTAAGCAGCGAGG -3'

Sequencing Primer
(F):5'- ATCCAAGCCTGAGGCAGTG -3'
(R):5'- acatacatacatacacacatacacac -3'
Posted On2014-04-24