Incidental Mutation 'R1633:Cacna2d1'
ID172907
Institutional Source Beutler Lab
Gene Symbol Cacna2d1
Ensembl Gene ENSMUSG00000040118
Gene Namecalcium channel, voltage-dependent, alpha2/delta subunit 1
SynonymsCa(v)alpha2delta1, Cacna2, Cchl2a
MMRRC Submission 039670-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.345) question?
Stock #R1633 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location15934691-16374511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16320116 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 516 (D516E)
Ref Sequence ENSEMBL: ENSMUSP00000142881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039370] [ENSMUST00000078272] [ENSMUST00000101581] [ENSMUST00000115281] [ENSMUST00000167946] [ENSMUST00000180204] [ENSMUST00000199704]
Predicted Effect probably damaging
Transcript: ENSMUST00000039370
AA Change: D516E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049457
Gene: ENSMUSG00000040118
AA Change: D516E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.3e-42 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 536 1e-31 PFAM
Pfam:VGCC_alpha2 562 655 1e-46 PFAM
low complexity region 675 686 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000078272
AA Change: D516E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077391
Gene: ENSMUSG00000040118
AA Change: D516E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 1.1e-30 PFAM
Pfam:VGCC_alpha2 543 634 3.3e-53 PFAM
low complexity region 656 667 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101581
AA Change: D516E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099117
Gene: ENSMUSG00000040118
AA Change: D516E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 1.1e-30 PFAM
Pfam:VGCC_alpha2 543 636 1.2e-59 PFAM
low complexity region 663 674 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115281
AA Change: D516E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110936
Gene: ENSMUSG00000040118
AA Change: D516E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.2e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 3.8e-30 PFAM
Pfam:VGCC_alpha2 538 631 6.2e-60 PFAM
low complexity region 658 669 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167946
AA Change: D516E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131507
Gene: ENSMUSG00000040118
AA Change: D516E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 3.8e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 2.6e-30 PFAM
Pfam:VGCC_alpha2 543 636 5.5e-56 PFAM
low complexity region 663 674 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000180204
AA Change: D516E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136260
Gene: ENSMUSG00000040118
AA Change: D516E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.2e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 3.8e-30 PFAM
Pfam:VGCC_alpha2 538 631 6.2e-60 PFAM
low complexity region 658 669 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199704
AA Change: D516E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142881
Gene: ENSMUSG00000040118
AA Change: D516E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 6.3e-30 PFAM
Pfam:VGCC_alpha2 538 629 3.3e-53 PFAM
low complexity region 651 662 N/A INTRINSIC
Meta Mutation Damage Score 0.26 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.9%
  • 20x: 83.9%
Validation Efficiency 94% (68/72)
MGI Phenotype FUNCTION: This gene encodes a regulatory component of the voltage-dependent calcium channel complex. The product of this gene is a proprotein that is proteolytically processed into alpha-2 and delta subunits, which are linked by a disulfide bond. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice with a point mutation allele exhibit abnormal CNS synaptic transmission and decreased response to pregabalin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd C T 1: 127,753,855 A185V probably benign Het
Acsl6 T C 11: 54,328,398 probably benign Het
Arel1 A G 12: 84,926,283 F580S probably damaging Het
Arhgef19 T C 4: 141,238,560 probably benign Het
Bpifb3 T A 2: 153,922,584 L132Q probably damaging Het
Ccar1 T C 10: 62,751,014 R882G unknown Het
Cep162 T C 9: 87,203,683 E1196G probably benign Het
Cpt1b T C 15: 89,418,815 T649A probably damaging Het
Cttnbp2 A T 6: 18,435,167 S231T probably damaging Het
Dgcr14 A G 16: 17,909,967 V116A probably benign Het
Dock8 A G 19: 25,051,563 T44A probably benign Het
Edrf1 T C 7: 133,652,140 S536P probably damaging Het
Eif5 T A 12: 111,540,287 N104K probably damaging Het
Enpp3 T C 10: 24,795,782 Y438C probably damaging Het
Fam208b A T 13: 3,581,771 I910N possibly damaging Het
Galnt4 T C 10: 99,109,952 V513A possibly damaging Het
Gdpd5 T C 7: 99,448,513 I172T probably benign Het
Ggt7 C T 2: 155,502,688 G245D probably damaging Het
Gm5884 A T 6: 128,646,065 noncoding transcript Het
Herc2 G A 7: 56,229,369 G4669R probably null Het
Hydin T A 8: 110,506,982 D1817E probably benign Het
Igf2r A C 17: 12,726,309 N359K probably benign Het
Itgb4 T C 11: 116,007,760 F1722L probably damaging Het
Itih3 T A 14: 30,917,398 E406V possibly damaging Het
Lamc2 A T 1: 153,141,698 C514* probably null Het
Mepe G T 5: 104,337,674 V227F probably benign Het
Nadk C T 4: 155,577,185 T56I probably damaging Het
Nedd4 G A 9: 72,671,257 V84I possibly damaging Het
Nipal3 C A 4: 135,447,348 R364L probably benign Het
Nkx2-9 T C 12: 56,612,981 R27G probably benign Het
Noc2l T A 4: 156,245,293 S600T probably benign Het
Olfr15 A C 16: 3,839,532 K186N probably damaging Het
Olfr364-ps1 T A 2: 37,146,971 I253N probably damaging Het
Olfr98 T A 17: 37,263,662 M1L probably benign Het
Pax6 A T 2: 105,691,718 E240V probably damaging Het
Pdilt T G 7: 119,487,994 T478P probably damaging Het
Phldb1 T A 9: 44,718,322 I25F probably damaging Het
Rad50 C T 11: 53,692,859 R365Q probably benign Het
Rdh10 A G 1: 16,128,196 E186G possibly damaging Het
Rdh12 A T 12: 79,218,724 E224V probably damaging Het
Reck T C 4: 43,922,964 V413A possibly damaging Het
Scn8a A G 15: 101,029,815 I1392V probably benign Het
Simc1 G A 13: 54,525,231 G464D probably benign Het
Srf A T 17: 46,551,608 V318E probably damaging Het
Stab1 T C 14: 31,150,380 probably null Het
Stk3 T C 15: 34,959,060 D322G probably damaging Het
Stxbp4 A G 11: 90,540,160 probably benign Het
Sult2a1 A G 7: 13,801,426 I234T probably benign Het
Syne1 A G 10: 5,349,388 F956L probably damaging Het
Thsd7a G T 6: 12,471,104 S505* probably null Het
Tmem63a T A 1: 180,948,826 V67E probably damaging Het
Tram2 A T 1: 21,003,922 V264E probably damaging Het
Trpv5 A T 6: 41,675,920 C106* probably null Het
Tspyl5 T A 15: 33,686,645 K385* probably null Het
Vezt T A 10: 93,984,276 Q409L probably damaging Het
Vmn2r79 T C 7: 87,037,834 C808R possibly damaging Het
Wdfy3 A C 5: 101,981,548 V4G probably damaging Het
Wdr95 A T 5: 149,593,172 I493F probably damaging Het
Zfhx4 A T 3: 5,400,413 N1877I probably damaging Het
Zfp180 A G 7: 24,104,801 D215G probably benign Het
Zfp442 A T 2: 150,408,340 Y490* probably null Het
Zfp804b A G 5: 7,179,513 probably benign Het
Other mutations in Cacna2d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cacna2d1 APN 5 16212944 missense probably damaging 1.00
IGL00470:Cacna2d1 APN 5 16246656 splice site probably benign
IGL00495:Cacna2d1 APN 5 16370609 missense probably benign 0.05
IGL00538:Cacna2d1 APN 5 16246785 nonsense probably null
IGL00990:Cacna2d1 APN 5 15935069 missense probably benign 0.23
IGL01079:Cacna2d1 APN 5 16370648 missense probably benign 0.03
IGL01344:Cacna2d1 APN 5 16370631 missense probably benign 0.26
IGL01597:Cacna2d1 APN 5 16326392 splice site probably benign
IGL01645:Cacna2d1 APN 5 16012391 splice site probably null
IGL01959:Cacna2d1 APN 5 16212897 missense probably benign 0.00
IGL02397:Cacna2d1 APN 5 16320164 splice site probably benign
IGL03152:Cacna2d1 APN 5 16322568 missense probably benign 0.00
IGL03216:Cacna2d1 APN 5 16353842 missense probably damaging 0.98
IGL03374:Cacna2d1 APN 5 16356823 missense probably damaging 0.99
R0158:Cacna2d1 UTSW 5 16361817 splice site probably benign
R0457:Cacna2d1 UTSW 5 16267416 missense probably damaging 1.00
R0477:Cacna2d1 UTSW 5 16194798 critical splice donor site probably null
R0483:Cacna2d1 UTSW 5 16359027 missense probably damaging 0.98
R0532:Cacna2d1 UTSW 5 16362273 missense probably benign 0.13
R0552:Cacna2d1 UTSW 5 16328043 missense probably damaging 1.00
R0924:Cacna2d1 UTSW 5 16365862 missense possibly damaging 0.79
R0930:Cacna2d1 UTSW 5 16365862 missense possibly damaging 0.79
R1144:Cacna2d1 UTSW 5 16322597 critical splice donor site probably null
R1164:Cacna2d1 UTSW 5 16361876 critical splice donor site probably null
R1398:Cacna2d1 UTSW 5 16357766 missense possibly damaging 0.47
R1440:Cacna2d1 UTSW 5 16355495 missense probably damaging 1.00
R1543:Cacna2d1 UTSW 5 16266718 missense possibly damaging 0.62
R1573:Cacna2d1 UTSW 5 16370627 missense probably damaging 1.00
R1673:Cacna2d1 UTSW 5 16299990 missense probably damaging 1.00
R1750:Cacna2d1 UTSW 5 16264288 missense probably benign 0.01
R1753:Cacna2d1 UTSW 5 16302354 missense possibly damaging 0.95
R1966:Cacna2d1 UTSW 5 16333785 nonsense probably null
R2163:Cacna2d1 UTSW 5 16362319 missense probably damaging 1.00
R2258:Cacna2d1 UTSW 5 16357289 missense probably damaging 1.00
R2870:Cacna2d1 UTSW 5 16312568 missense probably damaging 1.00
R2870:Cacna2d1 UTSW 5 16312568 missense probably damaging 1.00
R4303:Cacna2d1 UTSW 5 16302248 intron probably null
R4804:Cacna2d1 UTSW 5 16359208 missense probably damaging 0.97
R5032:Cacna2d1 UTSW 5 16359070 missense probably damaging 1.00
R5080:Cacna2d1 UTSW 5 16362396 critical splice donor site probably null
R5466:Cacna2d1 UTSW 5 16246714 missense probably damaging 1.00
R5469:Cacna2d1 UTSW 5 16352678 missense probably damaging 0.99
R5564:Cacna2d1 UTSW 5 16312519 missense probably damaging 1.00
R5655:Cacna2d1 UTSW 5 16302335 missense probably damaging 1.00
R5688:Cacna2d1 UTSW 5 16358952 missense probably damaging 0.99
R5729:Cacna2d1 UTSW 5 15935039 nonsense probably null
R6005:Cacna2d1 UTSW 5 16361821 missense probably damaging 1.00
R6343:Cacna2d1 UTSW 5 16322564 missense probably benign 0.09
R6485:Cacna2d1 UTSW 5 16354657 missense probably damaging 1.00
R6486:Cacna2d1 UTSW 5 16319450 unclassified probably null
R6625:Cacna2d1 UTSW 5 16362393 missense probably null 1.00
R6700:Cacna2d1 UTSW 5 16365460 missense probably damaging 1.00
R6706:Cacna2d1 UTSW 5 16326340 missense probably damaging 1.00
R6711:Cacna2d1 UTSW 5 16300041 missense probably damaging 1.00
Z1088:Cacna2d1 UTSW 5 16194763 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCATGTGGCTAATCTCCCAAAAGAG -3'
(R):5'- TTCTGAAGCAAACCTGTGGAGCTATC -3'

Sequencing Primer
(F):5'- CTAATCTCCCAAAAGAGTTTAAGAGC -3'
(R):5'- AGCAATGGCCTCTTAGAGC -3'
Posted On2014-04-24