Incidental Mutation 'R1633:Wdr95'
ID172910
Institutional Source Beutler Lab
Gene Symbol Wdr95
Ensembl Gene ENSMUSG00000029658
Gene NameWD40 repeat domain 95
Synonyms4930434E21Rik
MMRRC Submission 039670-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R1633 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location149528679-149611894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 149593172 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 493 (I493F)
Ref Sequence ENSEMBL: ENSMUSP00000144385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110502] [ENSMUST00000201525] [ENSMUST00000202902]
Predicted Effect probably damaging
Transcript: ENSMUST00000110502
AA Change: I351F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106128
Gene: ENSMUSG00000029658
AA Change: I351F

DomainStartEndE-ValueType
Pfam:WD40 4 28 3.3e-3 PFAM
WD40 32 71 4.38e-5 SMART
WD40 120 159 3.27e-4 SMART
WD40 162 203 1.71e-7 SMART
WD40 206 249 3.57e0 SMART
WD40 263 301 1.7e-2 SMART
Blast:WD40 315 363 3e-14 BLAST
Blast:WD40 367 408 4e-13 BLAST
WD40 421 460 2.01e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121108
AA Change: I493F

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113092
Gene: ENSMUSG00000029658
AA Change: I493F

DomainStartEndE-ValueType
Blast:WD40 44 83 9e-11 BLAST
WD40 132 170 1.61e-3 SMART
WD40 174 213 4.38e-5 SMART
WD40 262 301 3.27e-4 SMART
WD40 304 345 1.71e-7 SMART
WD40 348 391 3.57e0 SMART
WD40 405 443 1.7e-2 SMART
Blast:WD40 457 505 3e-14 BLAST
Blast:WD40 509 550 4e-13 BLAST
WD40 563 602 2.01e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201525
SMART Domains Protein: ENSMUSP00000144234
Gene: ENSMUSG00000029658

DomainStartEndE-ValueType
WD40 104 143 2e-6 SMART
WD40 146 187 1.1e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202635
Predicted Effect probably damaging
Transcript: ENSMUST00000202902
AA Change: I493F

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144385
Gene: ENSMUSG00000029658
AA Change: I493F

DomainStartEndE-ValueType
Blast:WD40 44 83 9e-11 BLAST
WD40 132 170 1.61e-3 SMART
WD40 174 213 4.38e-5 SMART
WD40 262 301 3.27e-4 SMART
WD40 304 345 1.71e-7 SMART
WD40 348 391 3.57e0 SMART
WD40 405 443 1.7e-2 SMART
Blast:WD40 457 505 3e-14 BLAST
Blast:WD40 509 550 4e-13 BLAST
WD40 563 602 2.01e-4 SMART
Meta Mutation Damage Score 0.0432 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.9%
  • 20x: 83.9%
Validation Efficiency 94% (68/72)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd C T 1: 127,753,855 A185V probably benign Het
Acsl6 T C 11: 54,328,398 probably benign Het
Arel1 A G 12: 84,926,283 F580S probably damaging Het
Arhgef19 T C 4: 141,238,560 probably benign Het
Bpifb3 T A 2: 153,922,584 L132Q probably damaging Het
Cacna2d1 T A 5: 16,320,116 D516E probably damaging Het
Ccar1 T C 10: 62,751,014 R882G unknown Het
Cep162 T C 9: 87,203,683 E1196G probably benign Het
Cpt1b T C 15: 89,418,815 T649A probably damaging Het
Cttnbp2 A T 6: 18,435,167 S231T probably damaging Het
Dgcr14 A G 16: 17,909,967 V116A probably benign Het
Dock8 A G 19: 25,051,563 T44A probably benign Het
Edrf1 T C 7: 133,652,140 S536P probably damaging Het
Eif5 T A 12: 111,540,287 N104K probably damaging Het
Enpp3 T C 10: 24,795,782 Y438C probably damaging Het
Fam208b A T 13: 3,581,771 I910N possibly damaging Het
Galnt4 T C 10: 99,109,952 V513A possibly damaging Het
Gdpd5 T C 7: 99,448,513 I172T probably benign Het
Ggt7 C T 2: 155,502,688 G245D probably damaging Het
Gm5884 A T 6: 128,646,065 noncoding transcript Het
Herc2 G A 7: 56,229,369 G4669R probably null Het
Hydin T A 8: 110,506,982 D1817E probably benign Het
Igf2r A C 17: 12,726,309 N359K probably benign Het
Itgb4 T C 11: 116,007,760 F1722L probably damaging Het
Itih3 T A 14: 30,917,398 E406V possibly damaging Het
Lamc2 A T 1: 153,141,698 C514* probably null Het
Mepe G T 5: 104,337,674 V227F probably benign Het
Nadk C T 4: 155,577,185 T56I probably damaging Het
Nedd4 G A 9: 72,671,257 V84I possibly damaging Het
Nipal3 C A 4: 135,447,348 R364L probably benign Het
Nkx2-9 T C 12: 56,612,981 R27G probably benign Het
Noc2l T A 4: 156,245,293 S600T probably benign Het
Olfr15 A C 16: 3,839,532 K186N probably damaging Het
Olfr364-ps1 T A 2: 37,146,971 I253N probably damaging Het
Olfr98 T A 17: 37,263,662 M1L probably benign Het
Pax6 A T 2: 105,691,718 E240V probably damaging Het
Pdilt T G 7: 119,487,994 T478P probably damaging Het
Phldb1 T A 9: 44,718,322 I25F probably damaging Het
Rad50 C T 11: 53,692,859 R365Q probably benign Het
Rdh10 A G 1: 16,128,196 E186G possibly damaging Het
Rdh12 A T 12: 79,218,724 E224V probably damaging Het
Reck T C 4: 43,922,964 V413A possibly damaging Het
Scn8a A G 15: 101,029,815 I1392V probably benign Het
Simc1 G A 13: 54,525,231 G464D probably benign Het
Srf A T 17: 46,551,608 V318E probably damaging Het
Stab1 T C 14: 31,150,380 probably null Het
Stk3 T C 15: 34,959,060 D322G probably damaging Het
Stxbp4 A G 11: 90,540,160 probably benign Het
Sult2a1 A G 7: 13,801,426 I234T probably benign Het
Syne1 A G 10: 5,349,388 F956L probably damaging Het
Thsd7a G T 6: 12,471,104 S505* probably null Het
Tmem63a T A 1: 180,948,826 V67E probably damaging Het
Tram2 A T 1: 21,003,922 V264E probably damaging Het
Trpv5 A T 6: 41,675,920 C106* probably null Het
Tspyl5 T A 15: 33,686,645 K385* probably null Het
Vezt T A 10: 93,984,276 Q409L probably damaging Het
Vmn2r79 T C 7: 87,037,834 C808R possibly damaging Het
Wdfy3 A C 5: 101,981,548 V4G probably damaging Het
Zfhx4 A T 3: 5,400,413 N1877I probably damaging Het
Zfp180 A G 7: 24,104,801 D215G probably benign Het
Zfp442 A T 2: 150,408,340 Y490* probably null Het
Zfp804b A G 5: 7,179,513 probably benign Het
Other mutations in Wdr95
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Wdr95 APN 5 149595244 critical splice acceptor site probably benign 0.00
IGL02352:Wdr95 APN 5 149580619 missense probably damaging 0.99
IGL02359:Wdr95 APN 5 149580619 missense probably damaging 0.99
IGL02478:Wdr95 APN 5 149596321 missense probably benign 0.02
IGL03078:Wdr95 APN 5 149611597 missense possibly damaging 0.63
IGL03201:Wdr95 APN 5 149581887 splice site probably null
P0037:Wdr95 UTSW 5 149588071 missense probably benign 0.27
R0115:Wdr95 UTSW 5 149564390 missense probably damaging 1.00
R0538:Wdr95 UTSW 5 149580806 missense probably damaging 1.00
R0606:Wdr95 UTSW 5 149588130 missense probably damaging 1.00
R0723:Wdr95 UTSW 5 149574048 missense probably damaging 1.00
R1104:Wdr95 UTSW 5 149606337 missense probably benign 0.00
R1233:Wdr95 UTSW 5 149581858 missense possibly damaging 0.61
R1233:Wdr95 UTSW 5 149595364 missense probably benign 0.00
R1344:Wdr95 UTSW 5 149588098 missense probably damaging 1.00
R1513:Wdr95 UTSW 5 149599294 missense probably benign 0.00
R1623:Wdr95 UTSW 5 149574116 missense probably damaging 1.00
R1664:Wdr95 UTSW 5 149595287 missense probably damaging 0.98
R1686:Wdr95 UTSW 5 149593101 missense probably damaging 1.00
R1741:Wdr95 UTSW 5 149595396 splice site probably null
R1750:Wdr95 UTSW 5 149581886 splice site probably null
R1774:Wdr95 UTSW 5 149564392 nonsense probably null
R1831:Wdr95 UTSW 5 149552426 missense probably damaging 1.00
R1838:Wdr95 UTSW 5 149599366 missense probably benign 0.00
R1907:Wdr95 UTSW 5 149552426 missense probably damaging 1.00
R2019:Wdr95 UTSW 5 149574148 splice site probably benign
R2063:Wdr95 UTSW 5 149579162 splice site probably null
R2392:Wdr95 UTSW 5 149580670 missense probably benign 0.03
R2863:Wdr95 UTSW 5 149581856 nonsense probably null
R4116:Wdr95 UTSW 5 149597575 missense probably benign 0.02
R4237:Wdr95 UTSW 5 149563337 nonsense probably null
R4420:Wdr95 UTSW 5 149532666 missense probably damaging 0.99
R4639:Wdr95 UTSW 5 149581814 splice site probably benign
R4824:Wdr95 UTSW 5 149595332 missense probably damaging 1.00
R4911:Wdr95 UTSW 5 149611692 nonsense probably null
R5016:Wdr95 UTSW 5 149544801 missense probably benign 0.00
R5458:Wdr95 UTSW 5 149564414 missense probably damaging 1.00
R5486:Wdr95 UTSW 5 149596330 nonsense probably null
R5613:Wdr95 UTSW 5 149584470 missense probably damaging 1.00
R5906:Wdr95 UTSW 5 149564227 missense possibly damaging 0.50
R5956:Wdr95 UTSW 5 149594482 missense probably benign 0.00
R6309:Wdr95 UTSW 5 149580803 critical splice acceptor site probably null
R6867:Wdr95 UTSW 5 149580923 intron probably null
R6964:Wdr95 UTSW 5 149581850 missense probably damaging 1.00
X0024:Wdr95 UTSW 5 149588167 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CCTGTTGGCTTTTCAAATGCTGCTG -3'
(R):5'- TCAATCTCCCCTGAAGGTGGTCTG -3'

Sequencing Primer
(F):5'- gagagagagagagagagagagag -3'
(R):5'- CTGGCATCCTAGCTACATGG -3'
Posted On2014-04-24