Incidental Mutation 'R1633:Nedd4'
ID172923
Institutional Source Beutler Lab
Gene Symbol Nedd4
Ensembl Gene ENSMUSG00000032216
Gene Nameneural precursor cell expressed, developmentally down-regulated 4
SynonymsNedd4, Nedd4-1, Nedd4a
MMRRC Submission 039670-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1633 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location72662346-72749852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72671257 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 84 (V84I)
Ref Sequence ENSEMBL: ENSMUSP00000034740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034740] [ENSMUST00000183375] [ENSMUST00000184333] [ENSMUST00000184450]
PDB Structure
Crystal structure of the Nedd4 C2/Grb10 SH2 complex [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034740
AA Change: V84I

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034740
Gene: ENSMUSG00000032216
AA Change: V84I

DomainStartEndE-ValueType
C2 79 181 5.38e-21 SMART
WW 250 282 2.32e-13 SMART
low complexity region 283 293 N/A INTRINSIC
WW 406 438 1.31e-12 SMART
WW 461 493 1.26e-14 SMART
HECTc 550 886 2.37e-194 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000183375
AA Change: V84I

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138852
Gene: ENSMUSG00000032216
AA Change: V84I

DomainStartEndE-ValueType
C2 79 163 1.12e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184180
Predicted Effect probably benign
Transcript: ENSMUST00000184333
SMART Domains Protein: ENSMUSP00000139190
Gene: ENSMUSG00000032216

DomainStartEndE-ValueType
C2 4 71 3.38e-4 SMART
WW 140 172 2.32e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184450
AA Change: V84I

PolyPhen 2 Score 0.475 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138983
Gene: ENSMUSG00000032216
AA Change: V84I

DomainStartEndE-ValueType
C2 79 181 5.38e-21 SMART
WW 250 282 2.32e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184737
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.9%
  • 20x: 83.9%
Validation Efficiency 94% (68/72)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in neonatal lethality and heterozygous mice have decreased body weights. Mice homozygous for a knockout allele exhibit impaired neurite development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd C T 1: 127,753,855 A185V probably benign Het
Acsl6 T C 11: 54,328,398 probably benign Het
Arel1 A G 12: 84,926,283 F580S probably damaging Het
Arhgef19 T C 4: 141,238,560 probably benign Het
Bpifb3 T A 2: 153,922,584 L132Q probably damaging Het
Cacna2d1 T A 5: 16,320,116 D516E probably damaging Het
Ccar1 T C 10: 62,751,014 R882G unknown Het
Cep162 T C 9: 87,203,683 E1196G probably benign Het
Cpt1b T C 15: 89,418,815 T649A probably damaging Het
Cttnbp2 A T 6: 18,435,167 S231T probably damaging Het
Dgcr14 A G 16: 17,909,967 V116A probably benign Het
Dock8 A G 19: 25,051,563 T44A probably benign Het
Edrf1 T C 7: 133,652,140 S536P probably damaging Het
Eif5 T A 12: 111,540,287 N104K probably damaging Het
Enpp3 T C 10: 24,795,782 Y438C probably damaging Het
Fam208b A T 13: 3,581,771 I910N possibly damaging Het
Galnt4 T C 10: 99,109,952 V513A possibly damaging Het
Gdpd5 T C 7: 99,448,513 I172T probably benign Het
Ggt7 C T 2: 155,502,688 G245D probably damaging Het
Gm5884 A T 6: 128,646,065 noncoding transcript Het
Herc2 G A 7: 56,229,369 G4669R probably null Het
Hydin T A 8: 110,506,982 D1817E probably benign Het
Igf2r A C 17: 12,726,309 N359K probably benign Het
Itgb4 T C 11: 116,007,760 F1722L probably damaging Het
Itih3 T A 14: 30,917,398 E406V possibly damaging Het
Lamc2 A T 1: 153,141,698 C514* probably null Het
Mepe G T 5: 104,337,674 V227F probably benign Het
Nadk C T 4: 155,577,185 T56I probably damaging Het
Nipal3 C A 4: 135,447,348 R364L probably benign Het
Nkx2-9 T C 12: 56,612,981 R27G probably benign Het
Noc2l T A 4: 156,245,293 S600T probably benign Het
Olfr15 A C 16: 3,839,532 K186N probably damaging Het
Olfr364-ps1 T A 2: 37,146,971 I253N probably damaging Het
Olfr98 T A 17: 37,263,662 M1L probably benign Het
Pax6 A T 2: 105,691,718 E240V probably damaging Het
Pdilt T G 7: 119,487,994 T478P probably damaging Het
Phldb1 T A 9: 44,718,322 I25F probably damaging Het
Rad50 C T 11: 53,692,859 R365Q probably benign Het
Rdh10 A G 1: 16,128,196 E186G possibly damaging Het
Rdh12 A T 12: 79,218,724 E224V probably damaging Het
Reck T C 4: 43,922,964 V413A possibly damaging Het
Scn8a A G 15: 101,029,815 I1392V probably benign Het
Simc1 G A 13: 54,525,231 G464D probably benign Het
Srf A T 17: 46,551,608 V318E probably damaging Het
Stab1 T C 14: 31,150,380 probably null Het
Stk3 T C 15: 34,959,060 D322G probably damaging Het
Stxbp4 A G 11: 90,540,160 probably benign Het
Sult2a1 A G 7: 13,801,426 I234T probably benign Het
Syne1 A G 10: 5,349,388 F956L probably damaging Het
Thsd7a G T 6: 12,471,104 S505* probably null Het
Tmem63a T A 1: 180,948,826 V67E probably damaging Het
Tram2 A T 1: 21,003,922 V264E probably damaging Het
Trpv5 A T 6: 41,675,920 C106* probably null Het
Tspyl5 T A 15: 33,686,645 K385* probably null Het
Vezt T A 10: 93,984,276 Q409L probably damaging Het
Vmn2r79 T C 7: 87,037,834 C808R possibly damaging Het
Wdfy3 A C 5: 101,981,548 V4G probably damaging Het
Wdr95 A T 5: 149,593,172 I493F probably damaging Het
Zfhx4 A T 3: 5,400,413 N1877I probably damaging Het
Zfp180 A G 7: 24,104,801 D215G probably benign Het
Zfp442 A T 2: 150,408,340 Y490* probably null Het
Zfp804b A G 5: 7,179,513 probably benign Het
Other mutations in Nedd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Nedd4 APN 9 72735089 missense probably damaging 1.00
IGL00573:Nedd4 APN 9 72686056 splice site probably null
IGL01973:Nedd4 APN 9 72736934 missense possibly damaging 0.81
IGL02177:Nedd4 APN 9 72747157 missense probably damaging 1.00
IGL03082:Nedd4 APN 9 72677394 critical splice donor site probably null
R0194:Nedd4 UTSW 9 72670053 missense possibly damaging 0.72
R0714:Nedd4 UTSW 9 72731446 splice site probably benign
R1331:Nedd4 UTSW 9 72677386 missense probably damaging 1.00
R1764:Nedd4 UTSW 9 72730907 missense probably damaging 0.99
R2192:Nedd4 UTSW 9 72742718 missense probably damaging 0.99
R2196:Nedd4 UTSW 9 72725074 missense possibly damaging 0.77
R2220:Nedd4 UTSW 9 72736707 missense probably damaging 1.00
R2850:Nedd4 UTSW 9 72725074 missense possibly damaging 0.77
R2994:Nedd4 UTSW 9 72730903 missense probably benign 0.04
R3040:Nedd4 UTSW 9 72669961 missense probably benign
R3697:Nedd4 UTSW 9 72740187 missense probably damaging 1.00
R3884:Nedd4 UTSW 9 72725077 missense probably benign 0.16
R4475:Nedd4 UTSW 9 72671239 nonsense probably null
R4476:Nedd4 UTSW 9 72671239 nonsense probably null
R4883:Nedd4 UTSW 9 72740233 splice site probably null
R5066:Nedd4 UTSW 9 72710519 missense probably damaging 1.00
R5947:Nedd4 UTSW 9 72730850 intron probably benign
R5974:Nedd4 UTSW 9 72743638 critical splice donor site probably null
R6247:Nedd4 UTSW 9 72726438 missense probably damaging 1.00
R6651:Nedd4 UTSW 9 72731271 missense possibly damaging 0.49
R6661:Nedd4 UTSW 9 72686095 missense probably damaging 1.00
Z1088:Nedd4 UTSW 9 72670078 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ACACAGCAACAGTGGTAACTTCCTTAG -3'
(R):5'- TCAGCCACTTACCCTGTAAGGATCTC -3'

Sequencing Primer
(F):5'- cacccgactgctcttcc -3'
(R):5'- TGTAAGGATCTCACTGTGTACC -3'
Posted On2014-04-24