Incidental Mutation 'R1633:Vezt'
ID172928
Institutional Source Beutler Lab
Gene Symbol Vezt
Ensembl Gene ENSMUSG00000036099
Gene Namevezatin, adherens junctions transmembrane protein
Synonyms
MMRRC Submission 039670-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1633 (G1)
Quality Score93
Status Validated
Chromosome10
Chromosomal Location93939165-94035817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93984276 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 409 (Q409L)
Ref Sequence ENSEMBL: ENSMUSP00000113715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047711] [ENSMUST00000118077] [ENSMUST00000118205] [ENSMUST00000119818] [ENSMUST00000141241] [ENSMUST00000150704]
Predicted Effect probably damaging
Transcript: ENSMUST00000047711
AA Change: Q405L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000037955
Gene: ENSMUSG00000036099
AA Change: Q405L

DomainStartEndE-ValueType
low complexity region 100 117 N/A INTRINSIC
Pfam:Vezatin 149 440 1.6e-60 PFAM
low complexity region 566 581 N/A INTRINSIC
low complexity region 702 715 N/A INTRINSIC
low complexity region 764 779 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118077
AA Change: Q405L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113983
Gene: ENSMUSG00000036099
AA Change: Q405L

DomainStartEndE-ValueType
low complexity region 100 117 N/A INTRINSIC
Pfam:Vezatin 149 440 9.2e-61 PFAM
low complexity region 566 581 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118205
AA Change: Q405L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113321
Gene: ENSMUSG00000036099
AA Change: Q405L

DomainStartEndE-ValueType
low complexity region 100 117 N/A INTRINSIC
Pfam:Vezatin 149 440 1e-60 PFAM
low complexity region 566 581 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119818
AA Change: Q409L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113715
Gene: ENSMUSG00000036099
AA Change: Q409L

DomainStartEndE-ValueType
low complexity region 100 117 N/A INTRINSIC
Pfam:Vezatin 150 442 1e-93 PFAM
low complexity region 570 585 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
low complexity region 768 783 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141241
SMART Domains Protein: ENSMUSP00000123575
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
Pfam:Vezatin 1 97 1.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150704
SMART Domains Protein: ENSMUSP00000121727
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
low complexity region 100 117 N/A INTRINSIC
Pfam:Vezatin 149 256 1.7e-18 PFAM
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.9%
  • 20x: 83.9%
Validation Efficiency 94% (68/72)
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that is essential for the formation of adherens junctions. It is required for both the pre-implantation morphogenesis of a blastocyst and for the implantation process. The encoded protein is also a component of the ankle-link complex in cochlear hair cells, where it may effect resilience to sound trauma. It is also thought to be involved in dendritic spine morphogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a null allele develop to the blastocyst stage inducing a decidual response but die at implantation. Only about half of blastocysts are able to hatch upon in vitro culture and mutant outgrowths show severe defects in intercellular adhesion and signs of cellular degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd C T 1: 127,753,855 A185V probably benign Het
Acsl6 T C 11: 54,328,398 probably benign Het
Arel1 A G 12: 84,926,283 F580S probably damaging Het
Arhgef19 T C 4: 141,238,560 probably benign Het
Bpifb3 T A 2: 153,922,584 L132Q probably damaging Het
Cacna2d1 T A 5: 16,320,116 D516E probably damaging Het
Ccar1 T C 10: 62,751,014 R882G unknown Het
Cep162 T C 9: 87,203,683 E1196G probably benign Het
Cpt1b T C 15: 89,418,815 T649A probably damaging Het
Cttnbp2 A T 6: 18,435,167 S231T probably damaging Het
Dgcr14 A G 16: 17,909,967 V116A probably benign Het
Dock8 A G 19: 25,051,563 T44A probably benign Het
Edrf1 T C 7: 133,652,140 S536P probably damaging Het
Eif5 T A 12: 111,540,287 N104K probably damaging Het
Enpp3 T C 10: 24,795,782 Y438C probably damaging Het
Fam208b A T 13: 3,581,771 I910N possibly damaging Het
Galnt4 T C 10: 99,109,952 V513A possibly damaging Het
Gdpd5 T C 7: 99,448,513 I172T probably benign Het
Ggt7 C T 2: 155,502,688 G245D probably damaging Het
Gm5884 A T 6: 128,646,065 noncoding transcript Het
Herc2 G A 7: 56,229,369 G4669R probably null Het
Hydin T A 8: 110,506,982 D1817E probably benign Het
Igf2r A C 17: 12,726,309 N359K probably benign Het
Itgb4 T C 11: 116,007,760 F1722L probably damaging Het
Itih3 T A 14: 30,917,398 E406V possibly damaging Het
Lamc2 A T 1: 153,141,698 C514* probably null Het
Mepe G T 5: 104,337,674 V227F probably benign Het
Nadk C T 4: 155,577,185 T56I probably damaging Het
Nedd4 G A 9: 72,671,257 V84I possibly damaging Het
Nipal3 C A 4: 135,447,348 R364L probably benign Het
Nkx2-9 T C 12: 56,612,981 R27G probably benign Het
Noc2l T A 4: 156,245,293 S600T probably benign Het
Olfr15 A C 16: 3,839,532 K186N probably damaging Het
Olfr364-ps1 T A 2: 37,146,971 I253N probably damaging Het
Olfr98 T A 17: 37,263,662 M1L probably benign Het
Pax6 A T 2: 105,691,718 E240V probably damaging Het
Pdilt T G 7: 119,487,994 T478P probably damaging Het
Phldb1 T A 9: 44,718,322 I25F probably damaging Het
Rad50 C T 11: 53,692,859 R365Q probably benign Het
Rdh10 A G 1: 16,128,196 E186G possibly damaging Het
Rdh12 A T 12: 79,218,724 E224V probably damaging Het
Reck T C 4: 43,922,964 V413A possibly damaging Het
Scn8a A G 15: 101,029,815 I1392V probably benign Het
Simc1 G A 13: 54,525,231 G464D probably benign Het
Srf A T 17: 46,551,608 V318E probably damaging Het
Stab1 T C 14: 31,150,380 probably null Het
Stk3 T C 15: 34,959,060 D322G probably damaging Het
Stxbp4 A G 11: 90,540,160 probably benign Het
Sult2a1 A G 7: 13,801,426 I234T probably benign Het
Syne1 A G 10: 5,349,388 F956L probably damaging Het
Thsd7a G T 6: 12,471,104 S505* probably null Het
Tmem63a T A 1: 180,948,826 V67E probably damaging Het
Tram2 A T 1: 21,003,922 V264E probably damaging Het
Trpv5 A T 6: 41,675,920 C106* probably null Het
Tspyl5 T A 15: 33,686,645 K385* probably null Het
Vmn2r79 T C 7: 87,037,834 C808R possibly damaging Het
Wdfy3 A C 5: 101,981,548 V4G probably damaging Het
Wdr95 A T 5: 149,593,172 I493F probably damaging Het
Zfhx4 A T 3: 5,400,413 N1877I probably damaging Het
Zfp180 A G 7: 24,104,801 D215G probably benign Het
Zfp442 A T 2: 150,408,340 Y490* probably null Het
Zfp804b A G 5: 7,179,513 probably benign Het
Other mutations in Vezt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Vezt APN 10 93996857 missense probably damaging 1.00
IGL01655:Vezt APN 10 93996997 missense probably benign 0.00
IGL02014:Vezt APN 10 93996949 missense probably benign 0.35
IGL03072:Vezt APN 10 93974033 missense probably damaging 1.00
R0542:Vezt UTSW 10 94007096 critical splice acceptor site probably null
R1757:Vezt UTSW 10 93970563 missense probably benign
R1808:Vezt UTSW 10 93990164 missense probably damaging 1.00
R4296:Vezt UTSW 10 93973931 small deletion probably benign
R4972:Vezt UTSW 10 94000350 critical splice donor site probably null
R5079:Vezt UTSW 10 94020624 splice site probably null
R5137:Vezt UTSW 10 93970510 missense probably benign 0.00
R5319:Vezt UTSW 10 93970331 missense probably benign
R5743:Vezt UTSW 10 93997095 missense probably benign 0.01
R6002:Vezt UTSW 10 94000474 missense probably damaging 1.00
R6281:Vezt UTSW 10 93973946 missense probably benign 0.04
R6652:Vezt UTSW 10 93970279 missense probably damaging 1.00
R6681:Vezt UTSW 10 93996997 missense probably benign 0.00
R6914:Vezt UTSW 10 93970451 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGCCCAAATGGACTGAGAGTGAC -3'
(R):5'- CCCAACTCACAGCTTATGACTGCG -3'

Sequencing Primer
(F):5'- ACTGAGAGTGACAGTTGCTTAC -3'
(R):5'- CACAGCTTATGACTGCGTATTTCAG -3'
Posted On2014-04-24