Incidental Mutation 'R1634:Dgki'
ID172973
Institutional Source Beutler Lab
Gene Symbol Dgki
Ensembl Gene ENSMUSG00000038665
Gene Namediacylglycerol kinase, iota
SynonymsC130010K08Rik
MMRRC Submission 039671-MU
Accession Numbers

Genbank: NM_001081206.1

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1634 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location36846022-37300184 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36915490 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 851 (M851T)
Ref Sequence ENSEMBL: ENSMUSP00000099071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042075] [ENSMUST00000090314] [ENSMUST00000101532] [ENSMUST00000138286] [ENSMUST00000150300]
Predicted Effect probably benign
Transcript: ENSMUST00000042075
AA Change: M679T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047858
Gene: ENSMUSG00000038665
AA Change: M679T

DomainStartEndE-ValueType
C1 22 76 3.67e-1 SMART
C1 95 153 5.92e-4 SMART
DAGKc 220 344 6.73e-58 SMART
DAGKa 370 527 2.29e-92 SMART
ANK 792 822 5.53e-3 SMART
ANK 828 857 2.07e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090314
AA Change: M830T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087788
Gene: ENSMUSG00000038665
AA Change: M830T

DomainStartEndE-ValueType
low complexity region 10 34 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
low complexity region 54 116 N/A INTRINSIC
C1 173 227 3.67e-1 SMART
C1 246 304 5.92e-4 SMART
DAGKc 371 495 6.73e-58 SMART
DAGKa 521 678 2.29e-92 SMART
ANK 943 973 5.53e-3 SMART
ANK 979 1008 2.07e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101532
AA Change: M851T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099071
Gene: ENSMUSG00000038665
AA Change: M851T

DomainStartEndE-ValueType
low complexity region 10 34 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
low complexity region 54 116 N/A INTRINSIC
C1 173 227 3.67e-1 SMART
C1 246 304 5.92e-4 SMART
DAGKc 371 495 6.73e-58 SMART
DAGKa 521 678 2.29e-92 SMART
ANK 964 994 5.53e-3 SMART
ANK 1000 1029 2.07e-2 SMART
Predicted Effect silent
Transcript: ENSMUST00000138286
SMART Domains Protein: ENSMUSP00000138628
Gene: ENSMUSG00000038665

DomainStartEndE-ValueType
low complexity region 10 34 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
low complexity region 54 116 N/A INTRINSIC
C1 173 227 1.8e-3 SMART
C1 246 304 2.9e-6 SMART
DAGKc 371 495 3.2e-60 SMART
DAGKa 521 678 1.1e-94 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143046
Predicted Effect probably benign
Transcript: ENSMUST00000150300
SMART Domains Protein: ENSMUSP00000138457
Gene: ENSMUSG00000038665

DomainStartEndE-ValueType
low complexity region 10 34 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
low complexity region 54 116 N/A INTRINSIC
C1 173 227 3.67e-1 SMART
C1 246 304 5.92e-4 SMART
DAGKc 371 495 6.73e-58 SMART
DAGKa 521 591 1.43e-6 SMART
Meta Mutation Damage Score 0.188 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.4%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type IV diacylglycerol kinase subfamily. Diacylglycerol kinases regulate the intracellular concentration of diacylglycerol through its phosphorylation, producing phosphatidic acid. The specific role of the enzyme encoded by this gene is undetermined, however, it may play a crucial role in the production of phosphatidic acid in the retina or in recessive forms of retinal degeneration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are grossly normal and do not develop tumors when wounded or when exposed to phorbol ester. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(1) Gene trapped(7)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam2 A T 14: 66,057,731 F222I probably damaging Het
Adam34 A T 8: 43,652,090 C173S possibly damaging Het
Ahi1 T C 10: 20,965,693 V293A probably damaging Het
AI182371 A T 2: 35,086,485 Y223N probably damaging Het
Armc4 A G 18: 7,286,688 L181P probably damaging Het
Asmt C A X: 170,675,829 F181L probably damaging Het
Axin1 T A 17: 26,187,991 H519Q probably damaging Het
Cdc5l A T 17: 45,404,706 V660E probably damaging Het
Cep152 C T 2: 125,583,889 R852H probably benign Het
Cpne4 T C 9: 104,989,579 V230A possibly damaging Het
Cttnbp2 A T 6: 18,408,657 N988K probably benign Het
D430041D05Rik A G 2: 104,221,211 I767T probably damaging Het
Dnah8 T C 17: 30,713,098 probably null Het
Dscaml1 A G 9: 45,672,749 E504G probably damaging Het
Dzank1 G A 2: 144,481,669 A618V probably benign Het
Fam189b A C 3: 89,188,094 Y511S probably damaging Het
Fat2 T A 11: 55,267,684 S3403C probably damaging Het
Fat2 C T 11: 55,284,719 V1723I probably benign Het
Flt1 A T 5: 147,676,430 F334I probably damaging Het
Galnt12 G T 4: 47,108,585 probably null Het
Gzmc T C 14: 56,232,280 I188V possibly damaging Het
Herc1 T C 9: 66,473,538 S3566P possibly damaging Het
Hoxb4 C A 11: 96,320,273 probably benign Het
Idh3b C T 2: 130,281,745 V141I probably benign Het
Kif24 A G 4: 41,393,529 S1249P probably benign Het
Leo1 T C 9: 75,466,260 Y656H possibly damaging Het
Map3k20 G A 2: 72,410,177 W339* probably null Het
Map3k5 T C 10: 20,136,911 V1259A possibly damaging Het
Masp2 A G 4: 148,614,355 D631G probably damaging Het
Mink1 T C 11: 70,608,880 S713P probably benign Het
Mpp7 A T 18: 7,350,984 V571E possibly damaging Het
Nell1 A G 7: 50,848,558 D574G possibly damaging Het
Obscn T C 11: 59,076,896 Y392C probably damaging Het
Olfml2a A T 2: 38,960,219 Y649F probably benign Het
Olfr1295 T C 2: 111,565,346 M33V probably benign Het
Olfr161 A G 16: 3,593,209 D271G probably benign Het
Prkcg A G 7: 3,323,470 D484G probably damaging Het
Rab27a T C 9: 73,075,569 probably null Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rgl1 C T 1: 152,524,772 R624H probably damaging Het
Ric8b G A 10: 84,970,748 G159D probably damaging Het
Sbno2 C A 10: 80,060,634 A880S possibly damaging Het
Scn9a A G 2: 66,488,017 S1477P probably damaging Het
Sec22a T C 16: 35,318,873 probably benign Het
Snx14 T C 9: 88,385,739 I714M probably benign Het
Snx14 T C 9: 88,407,490 probably benign Het
Sphk2 T A 7: 45,711,540 T347S probably benign Het
Spns1 C T 7: 126,371,171 probably benign Het
Susd2 A G 10: 75,637,555 V675A probably benign Het
Sytl2 A T 7: 90,395,182 D566V probably damaging Het
Tcf25 T A 8: 123,397,091 I464N possibly damaging Het
Tex261 A T 6: 83,775,022 I49N possibly damaging Het
Tjp1 A G 7: 65,302,952 F1545L possibly damaging Het
Tmem176b A G 6: 48,834,566 S216P probably damaging Het
Topaz1 C T 9: 122,780,675 probably benign Het
Tra2a C T 6: 49,250,957 probably benign Het
Ttn A G 2: 76,722,782 F22794S possibly damaging Het
Uox G A 3: 146,612,383 W93* probably null Het
Zan A T 5: 137,412,790 probably benign Het
Zfp106 G A 2: 120,533,677 R750* probably null Het
Zfp638 A T 6: 83,979,912 probably null Het
Other mutations in Dgki
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Dgki APN 6 36862456 missense probably benign 0.00
IGL00951:Dgki APN 6 37000159 missense probably damaging 0.97
IGL01087:Dgki APN 6 37012911 missense probably damaging 1.00
IGL01396:Dgki APN 6 37000090 missense probably damaging 1.00
IGL02113:Dgki APN 6 36913625 splice site probably benign
IGL02174:Dgki APN 6 37032921 missense probably damaging 1.00
IGL02215:Dgki APN 6 37016675 missense probably damaging 1.00
IGL02353:Dgki APN 6 36847389 missense probably damaging 1.00
IGL02360:Dgki APN 6 36847389 missense probably damaging 1.00
IGL02662:Dgki APN 6 36862486 splice site probably benign
IGL02891:Dgki APN 6 36913741 missense probably benign 0.15
IGL03040:Dgki APN 6 37149664 splice site probably benign
IGL03064:Dgki APN 6 37149664 splice site probably benign
IGL03283:Dgki APN 6 36937311 splice site probably benign
IGL03349:Dgki APN 6 37097627 critical splice acceptor site probably null
H8477:Dgki UTSW 6 37029851 splice site probably benign
PIT4151001:Dgki UTSW 6 37063981 missense probably benign 0.00
R0392:Dgki UTSW 6 37000178 missense probably damaging 1.00
R0630:Dgki UTSW 6 37000198 missense probably damaging 1.00
R0718:Dgki UTSW 6 37012896 missense probably damaging 1.00
R1420:Dgki UTSW 6 37050269 intron probably null
R1546:Dgki UTSW 6 37050203 missense probably damaging 1.00
R1639:Dgki UTSW 6 36937364 missense probably damaging 1.00
R1738:Dgki UTSW 6 37057432 missense possibly damaging 0.93
R1750:Dgki UTSW 6 36916434 missense probably damaging 0.96
R1808:Dgki UTSW 6 37149574 missense possibly damaging 0.84
R1834:Dgki UTSW 6 37034701 splice site probably benign
R2001:Dgki UTSW 6 36865801 missense possibly damaging 0.94
R2047:Dgki UTSW 6 36913646 missense possibly damaging 0.69
R2413:Dgki UTSW 6 36847473 missense possibly damaging 0.49
R3034:Dgki UTSW 6 37087670 missense probably damaging 1.00
R4493:Dgki UTSW 6 36974861 intron probably benign
R4684:Dgki UTSW 6 37299846 unclassified probably benign
R4727:Dgki UTSW 6 37299813 unclassified probably benign
R5104:Dgki UTSW 6 37149574 missense possibly damaging 0.84
R5756:Dgki UTSW 6 36937058 intron probably benign
R6946:Dgki UTSW 6 37299636 nonsense probably null
X0066:Dgki UTSW 6 37063997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGACAATTACAGAACCAAGTGCC -3'
(R):5'- TGGGATGCCACACCTTTGACAG -3'

Sequencing Primer
(F):5'- CAGAACCAAGTGCCTTTACTTTAC -3'
(R):5'- TTAGGTGTAAGTCCTGAACCAG -3'
Posted On2014-04-24