Incidental Mutation 'R1634:Spns1'
ID172984
Institutional Source Beutler Lab
Gene Symbol Spns1
Ensembl Gene ENSMUSG00000030741
Gene Namespinster homolog 1
Synonyms2210013K02Rik
MMRRC Submission 039671-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1634 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location126370060-126377450 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 126371171 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032994] [ENSMUST00000032997] [ENSMUST00000119754] [ENSMUST00000119846] [ENSMUST00000138141] [ENSMUST00000150476] [ENSMUST00000205366] [ENSMUST00000205642] [ENSMUST00000205930] [ENSMUST00000206793]
Predicted Effect probably benign
Transcript: ENSMUST00000032994
SMART Domains Protein: ENSMUSP00000032994
Gene: ENSMUSG00000030741

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:Sugar_tr 60 250 4.6e-15 PFAM
Pfam:OATP 60 385 1.5e-9 PFAM
Pfam:MFS_1 65 435 1.8e-34 PFAM
transmembrane domain 462 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000032997
SMART Domains Protein: ENSMUSP00000032997
Gene: ENSMUSG00000030742

DomainStartEndE-ValueType
Pfam:LAT 1 242 4.3e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119754
SMART Domains Protein: ENSMUSP00000112555
Gene: ENSMUSG00000030741

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:OATP 58 147 1.2e-8 PFAM
Pfam:Sugar_tr 60 250 1.3e-14 PFAM
Pfam:MFS_1 65 430 2.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119846
SMART Domains Protein: ENSMUSP00000112954
Gene: ENSMUSG00000030741

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:OATP 58 147 1.4e-8 PFAM
Pfam:Sugar_tr 60 250 1.5e-14 PFAM
Pfam:MFS_1 65 433 2.5e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137263
Predicted Effect probably benign
Transcript: ENSMUST00000138141
SMART Domains Protein: ENSMUSP00000117803
Gene: ENSMUSG00000030741

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:OATP 58 151 1.4e-9 PFAM
Pfam:MFS_1 65 149 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150476
SMART Domains Protein: ENSMUSP00000115152
Gene: ENSMUSG00000030741

DomainStartEndE-ValueType
Pfam:OATP 28 120 1.3e-8 PFAM
Pfam:Sugar_tr 28 220 1.6e-15 PFAM
Pfam:MFS_1 35 237 2.4e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184637
Predicted Effect probably benign
Transcript: ENSMUST00000205366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205398
Predicted Effect probably benign
Transcript: ENSMUST00000205642
Predicted Effect probably benign
Transcript: ENSMUST00000205930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206731
Predicted Effect probably benign
Transcript: ENSMUST00000206793
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.4%
Validation Efficiency 97% (67/69)
MGI Phenotype PHENOTYPE: Homozygous mutation results in lethality before weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam2 A T 14: 66,057,731 F222I probably damaging Het
Adam34 A T 8: 43,652,090 C173S possibly damaging Het
Ahi1 T C 10: 20,965,693 V293A probably damaging Het
AI182371 A T 2: 35,086,485 Y223N probably damaging Het
Armc4 A G 18: 7,286,688 L181P probably damaging Het
Asmt C A X: 170,675,829 F181L probably damaging Het
Axin1 T A 17: 26,187,991 H519Q probably damaging Het
Cdc5l A T 17: 45,404,706 V660E probably damaging Het
Cep152 C T 2: 125,583,889 R852H probably benign Het
Cpne4 T C 9: 104,989,579 V230A possibly damaging Het
Cttnbp2 A T 6: 18,408,657 N988K probably benign Het
D430041D05Rik A G 2: 104,221,211 I767T probably damaging Het
Dgki A G 6: 36,915,490 M851T probably benign Het
Dnah8 T C 17: 30,713,098 probably null Het
Dscaml1 A G 9: 45,672,749 E504G probably damaging Het
Dzank1 G A 2: 144,481,669 A618V probably benign Het
Fam189b A C 3: 89,188,094 Y511S probably damaging Het
Fat2 T A 11: 55,267,684 S3403C probably damaging Het
Fat2 C T 11: 55,284,719 V1723I probably benign Het
Flt1 A T 5: 147,676,430 F334I probably damaging Het
Galnt12 G T 4: 47,108,585 probably null Het
Gzmc T C 14: 56,232,280 I188V possibly damaging Het
Herc1 T C 9: 66,473,538 S3566P possibly damaging Het
Hoxb4 C A 11: 96,320,273 probably benign Het
Idh3b C T 2: 130,281,745 V141I probably benign Het
Kif24 A G 4: 41,393,529 S1249P probably benign Het
Leo1 T C 9: 75,466,260 Y656H possibly damaging Het
Map3k20 G A 2: 72,410,177 W339* probably null Het
Map3k5 T C 10: 20,136,911 V1259A possibly damaging Het
Masp2 A G 4: 148,614,355 D631G probably damaging Het
Mink1 T C 11: 70,608,880 S713P probably benign Het
Mpp7 A T 18: 7,350,984 V571E possibly damaging Het
Nell1 A G 7: 50,848,558 D574G possibly damaging Het
Obscn T C 11: 59,076,896 Y392C probably damaging Het
Olfml2a A T 2: 38,960,219 Y649F probably benign Het
Olfr1295 T C 2: 111,565,346 M33V probably benign Het
Olfr161 A G 16: 3,593,209 D271G probably benign Het
Prkcg A G 7: 3,323,470 D484G probably damaging Het
Rab27a T C 9: 73,075,569 probably null Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rgl1 C T 1: 152,524,772 R624H probably damaging Het
Ric8b G A 10: 84,970,748 G159D probably damaging Het
Sbno2 C A 10: 80,060,634 A880S possibly damaging Het
Scn9a A G 2: 66,488,017 S1477P probably damaging Het
Sec22a T C 16: 35,318,873 probably benign Het
Snx14 T C 9: 88,385,739 I714M probably benign Het
Snx14 T C 9: 88,407,490 probably benign Het
Sphk2 T A 7: 45,711,540 T347S probably benign Het
Susd2 A G 10: 75,637,555 V675A probably benign Het
Sytl2 A T 7: 90,395,182 D566V probably damaging Het
Tcf25 T A 8: 123,397,091 I464N possibly damaging Het
Tex261 A T 6: 83,775,022 I49N possibly damaging Het
Tjp1 A G 7: 65,302,952 F1545L possibly damaging Het
Tmem176b A G 6: 48,834,566 S216P probably damaging Het
Topaz1 C T 9: 122,780,675 probably benign Het
Tra2a C T 6: 49,250,957 probably benign Het
Ttn A G 2: 76,722,782 F22794S possibly damaging Het
Uox G A 3: 146,612,383 W93* probably null Het
Zan A T 5: 137,412,790 probably benign Het
Zfp106 G A 2: 120,533,677 R750* probably null Het
Zfp638 A T 6: 83,979,912 probably null Het
Other mutations in Spns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Spns1 APN 7 126371242 unclassified probably null
IGL02353:Spns1 APN 7 126375140 missense probably damaging 1.00
IGL02561:Spns1 APN 7 126373769 critical splice donor site probably null
IGL03403:Spns1 APN 7 126371536 splice site probably null
R2327:Spns1 UTSW 7 126370786 missense probably damaging 1.00
R3552:Spns1 UTSW 7 126370371 missense possibly damaging 0.94
R3916:Spns1 UTSW 7 126371539 critical splice donor site probably null
R4025:Spns1 UTSW 7 126376946 nonsense probably null
R4095:Spns1 UTSW 7 126370786 missense probably damaging 1.00
R4656:Spns1 UTSW 7 126374302 unclassified probably benign
R4657:Spns1 UTSW 7 126374302 unclassified probably benign
R4697:Spns1 UTSW 7 126377037 missense probably damaging 1.00
R4758:Spns1 UTSW 7 126370794 missense probably damaging 1.00
R5062:Spns1 UTSW 7 126374329 unclassified probably benign
R5371:Spns1 UTSW 7 126373764 unclassified probably benign
R5700:Spns1 UTSW 7 126372469 missense possibly damaging 0.95
R5973:Spns1 UTSW 7 126370323 missense probably damaging 1.00
R5985:Spns1 UTSW 7 126376730 missense probably benign 0.37
R6660:Spns1 UTSW 7 126375065 critical splice donor site probably null
R7175:Spns1 UTSW 7 126373789 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATAGGGTGAGACCCACAGCCTAAC -3'
(R):5'- GGAGTCTGGCTTTTCCCCTTCAAAC -3'

Sequencing Primer
(F):5'- TAACGGGCAAAACCTTCCTATG -3'
(R):5'- CCTGAGTGAAAATTTGTCATGGACC -3'
Posted On2014-04-24