Incidental Mutation 'R1634:Olfr161'
ID173009
Institutional Source Beutler Lab
Gene Symbol Olfr161
Ensembl Gene ENSMUSG00000051003
Gene Nameolfactory receptor 161
SynonymsMOR131-1, GA_x54KRFPKG5P-112942-113883
MMRRC Submission 039671-MU
Accession Numbers

Genbank: NM_146860; MGI: 3032605

Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R1634 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location3591042-3599323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3593209 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 271 (D271G)
Ref Sequence ENSEMBL: ENSMUSP00000150825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061541] [ENSMUST00000216259]
Predicted Effect probably benign
Transcript: ENSMUST00000061541
AA Change: D271G

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000058956
Gene: ENSMUSG00000051003
AA Change: D271G

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 6.4e-60 PFAM
Pfam:7TM_GPCR_Srsx 36 220 7.2e-6 PFAM
Pfam:7tm_1 42 291 2.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216259
AA Change: D271G

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.4%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam2 A T 14: 66,057,731 F222I probably damaging Het
Adam34 A T 8: 43,652,090 C173S possibly damaging Het
Ahi1 T C 10: 20,965,693 V293A probably damaging Het
AI182371 A T 2: 35,086,485 Y223N probably damaging Het
Armc4 A G 18: 7,286,688 L181P probably damaging Het
Asmt C A X: 170,675,829 F181L probably damaging Het
Axin1 T A 17: 26,187,991 H519Q probably damaging Het
Cdc5l A T 17: 45,404,706 V660E probably damaging Het
Cep152 C T 2: 125,583,889 R852H probably benign Het
Cpne4 T C 9: 104,989,579 V230A possibly damaging Het
Cttnbp2 A T 6: 18,408,657 N988K probably benign Het
D430041D05Rik A G 2: 104,221,211 I767T probably damaging Het
Dgki A G 6: 36,915,490 M851T probably benign Het
Dnah8 T C 17: 30,713,098 probably null Het
Dscaml1 A G 9: 45,672,749 E504G probably damaging Het
Dzank1 G A 2: 144,481,669 A618V probably benign Het
Fam189b A C 3: 89,188,094 Y511S probably damaging Het
Fat2 T A 11: 55,267,684 S3403C probably damaging Het
Fat2 C T 11: 55,284,719 V1723I probably benign Het
Flt1 A T 5: 147,676,430 F334I probably damaging Het
Galnt12 G T 4: 47,108,585 probably null Het
Gzmc T C 14: 56,232,280 I188V possibly damaging Het
Herc1 T C 9: 66,473,538 S3566P possibly damaging Het
Hoxb4 C A 11: 96,320,273 probably benign Het
Idh3b C T 2: 130,281,745 V141I probably benign Het
Kif24 A G 4: 41,393,529 S1249P probably benign Het
Leo1 T C 9: 75,466,260 Y656H possibly damaging Het
Map3k20 G A 2: 72,410,177 W339* probably null Het
Map3k5 T C 10: 20,136,911 V1259A possibly damaging Het
Masp2 A G 4: 148,614,355 D631G probably damaging Het
Mink1 T C 11: 70,608,880 S713P probably benign Het
Mpp7 A T 18: 7,350,984 V571E possibly damaging Het
Nell1 A G 7: 50,848,558 D574G possibly damaging Het
Obscn T C 11: 59,076,896 Y392C probably damaging Het
Olfml2a A T 2: 38,960,219 Y649F probably benign Het
Olfr1295 T C 2: 111,565,346 M33V probably benign Het
Prkcg A G 7: 3,323,470 D484G probably damaging Het
Rab27a T C 9: 73,075,569 probably null Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rgl1 C T 1: 152,524,772 R624H probably damaging Het
Ric8b G A 10: 84,970,748 G159D probably damaging Het
Sbno2 C A 10: 80,060,634 A880S possibly damaging Het
Scn9a A G 2: 66,488,017 S1477P probably damaging Het
Sec22a T C 16: 35,318,873 probably benign Het
Snx14 T C 9: 88,385,739 I714M probably benign Het
Snx14 T C 9: 88,407,490 probably benign Het
Sphk2 T A 7: 45,711,540 T347S probably benign Het
Spns1 C T 7: 126,371,171 probably benign Het
Susd2 A G 10: 75,637,555 V675A probably benign Het
Sytl2 A T 7: 90,395,182 D566V probably damaging Het
Tcf25 T A 8: 123,397,091 I464N possibly damaging Het
Tex261 A T 6: 83,775,022 I49N possibly damaging Het
Tjp1 A G 7: 65,302,952 F1545L possibly damaging Het
Tmem176b A G 6: 48,834,566 S216P probably damaging Het
Topaz1 C T 9: 122,780,675 probably benign Het
Tra2a C T 6: 49,250,957 probably benign Het
Ttn A G 2: 76,722,782 F22794S possibly damaging Het
Uox G A 3: 146,612,383 W93* probably null Het
Zan A T 5: 137,412,790 probably benign Het
Zfp106 G A 2: 120,533,677 R750* probably null Het
Zfp638 A T 6: 83,979,912 probably null Het
Other mutations in Olfr161
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Olfr161 APN 16 3592984 missense possibly damaging 0.55
IGL01519:Olfr161 APN 16 3592534 missense probably damaging 1.00
IGL02727:Olfr161 APN 16 3593326 missense probably benign 0.04
IGL03278:Olfr161 APN 16 3593107 missense possibly damaging 0.55
F6893:Olfr161 UTSW 16 3593163 missense possibly damaging 0.55
R2345:Olfr161 UTSW 16 3593139 missense probably damaging 0.99
R4858:Olfr161 UTSW 16 3592842 missense probably damaging 1.00
R4930:Olfr161 UTSW 16 3592435 missense probably damaging 1.00
R6774:Olfr161 UTSW 16 3592516 missense probably damaging 1.00
R7480:Olfr161 UTSW 16 3592629 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGTGACTCCCCTGCTGAAACTCTC -3'
(R):5'- GGTGCTCATGGTGAATTCTGCCAAG -3'

Sequencing Primer
(F):5'- TCAGACACACATCTCAATGAGTTG -3'
(R):5'- ACCTAAAGGATTTGTATCCTGGGC -3'
Posted On2014-04-24