Incidental Mutation 'R1635:Abca2'
ID173030
Institutional Source Beutler Lab
Gene Symbol Abca2
Ensembl Gene ENSMUSG00000026944
Gene NameATP-binding cassette, sub-family A (ABC1), member 2
SynonymsAbc2, D2H0S1474E
Accession Numbers

NCBI RefSeq: NM_007379.2; MGI: 99606

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1635 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25428703-25448540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25444856 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1947 (I1947F)
Ref Sequence ENSEMBL: ENSMUSP00000099983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102919]
Predicted Effect probably benign
Transcript: ENSMUST00000102919
AA Change: I1947F

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000099983
Gene: ENSMUSG00000026944
AA Change: I1947F

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
low complexity region 220 237 N/A INTRINSIC
coiled coil region 271 296 N/A INTRINSIC
low complexity region 309 346 N/A INTRINSIC
Pfam:ABC2_membrane_3 493 911 9.7e-18 PFAM
AAA 1015 1197 9.22e-7 SMART
low complexity region 1364 1376 N/A INTRINSIC
low complexity region 1589 1607 N/A INTRINSIC
Pfam:ABC2_membrane_3 1696 2008 2.3e-44 PFAM
AAA 2079 2264 1.12e-5 SMART
low complexity region 2375 2394 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141065
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150550
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199405
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype Strain: 3697467; 3719855
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is highly expressed in brain tissue and may play a role in macrophage lipid metabolism and neural development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null mice show tremors, hyperactivity, abnormal coordination, and alterations in CNS myelin sheath ultrastructure, [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 G T 5: 129,128,907 V182F probably damaging Het
Agmat A G 4: 141,747,069 D87G probably damaging Het
AI182371 T C 2: 35,088,737 probably null Het
Anapc1 G T 2: 128,628,532 H1559Q probably damaging Het
Ankar T C 1: 72,650,138 Y1278C probably damaging Het
Arhgef2 A T 3: 88,639,321 probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Banp A T 8: 122,001,011 I130F probably damaging Het
C130050O18Rik G T 5: 139,414,493 R100S probably benign Het
Carmil3 A G 14: 55,496,282 T374A possibly damaging Het
Cc2d2a T A 5: 43,722,470 W1076R probably damaging Het
Cdc34 T G 10: 79,688,054 S235A probably benign Het
Cdh8 G T 8: 99,031,024 H647Q probably damaging Het
Cdk1 A T 10: 69,338,547 L282Q probably damaging Het
Ceacam3 A G 7: 17,159,977 D471G probably damaging Het
Cltc A T 11: 86,757,279 I4N probably benign Het
Cntfr T A 4: 41,658,816 E305V probably damaging Het
Cwh43 T A 5: 73,434,310 I496N probably damaging Het
Cyp2f2 A G 7: 27,129,724 N218S probably benign Het
D16Ertd472e A G 16: 78,546,504 probably null Het
Dab2 A G 15: 6,429,870 Q400R possibly damaging Het
Dapl1 A T 2: 59,496,562 I51F probably benign Het
Drc7 G A 8: 95,074,332 probably null Het
Etl4 A G 2: 20,806,408 T1101A probably damaging Het
Fam83c C A 2: 155,830,051 R488M possibly damaging Het
Fam96b A T 8: 104,640,988 I108N possibly damaging Het
Fbxo42 A G 4: 141,200,529 T707A probably damaging Het
Fcmr A T 1: 130,876,185 probably null Het
Fer1l6 G C 15: 58,647,081 K1687N probably damaging Het
Fgd4 G A 16: 16,475,029 R275* probably null Het
Fxr2 G A 11: 69,641,313 C87Y possibly damaging Het
Gja4 A T 4: 127,312,679 I97N probably damaging Het
Gm136 A G 4: 34,750,919 probably null Het
Gm14496 A G 2: 182,001,044 D836G possibly damaging Het
Gm8882 A G 6: 132,363,006 probably null Het
Grm3 T A 5: 9,511,520 T777S probably damaging Het
Guca2b A G 4: 119,657,715 Y50H probably damaging Het
Herc2 C T 7: 56,136,667 P1587S probably benign Het
Hmcn1 C T 1: 150,669,558 S2766N probably benign Het
Idi2 T A 13: 8,959,419 I224K probably damaging Het
Kmt2a A T 9: 44,824,369 probably benign Het
Lonp2 A T 8: 86,713,450 M693L possibly damaging Het
Megf8 G T 7: 25,346,747 M1525I possibly damaging Het
Mgme1 T C 2: 144,279,098 V276A possibly damaging Het
Mief2 G T 11: 60,731,408 W268L probably damaging Het
Mpped1 C T 15: 83,791,990 probably benign Het
Mreg T C 1: 72,192,197 N34S probably benign Het
Myf6 T C 10: 107,494,673 Y11C probably damaging Het
Myh9 C A 15: 77,771,167 Q1196H probably benign Het
Myh9 A T 15: 77,775,899 D56E probably benign Het
Myo5c A T 9: 75,277,075 R949S probably benign Het
Ncapg2 TAA TA 12: 116,434,685 probably null Het
Nfx1 T A 4: 40,977,004 V226E probably benign Het
Nlrp10 T A 7: 108,924,530 K581M possibly damaging Het
Nmd3 T G 3: 69,739,984 I273S probably benign Het
Olfr1264 A T 2: 90,021,970 I32N possibly damaging Het
P4hb T C 11: 120,571,616 E88G probably damaging Het
Pcnx3 A T 19: 5,665,745 H1444Q probably benign Het
Pdia4 A T 6: 47,799,199 F421L possibly damaging Het
Picalm T A 7: 90,191,251 S538T probably damaging Het
Ppp2r2b T A 18: 43,059,210 I11F probably benign Het
Ptk7 C T 17: 46,573,534 E757K possibly damaging Het
Rbm22 T G 18: 60,561,268 C24W probably damaging Het
Rev3l A G 10: 39,806,662 D288G probably damaging Het
Rgs18 T A 1: 144,754,053 H156L probably benign Het
Rnf213 A G 11: 119,442,579 I2871M probably damaging Het
Rrm2b A T 15: 37,945,084 M137K probably damaging Het
Rrp12 A T 19: 41,868,785 D1183E probably benign Het
Sacs G A 14: 61,203,828 V1108M probably damaging Het
Scube2 A T 7: 109,843,214 D270E possibly damaging Het
Serpina3a T A 12: 104,116,478 F170Y probably damaging Het
Serpinb3b T C 1: 107,154,673 E287G probably benign Het
Slamf8 C T 1: 172,584,619 V130M probably damaging Het
Slc5a3 T C 16: 92,077,396 S114P possibly damaging Het
Sos1 T A 17: 80,422,679 probably null Het
Sox10 A T 15: 79,156,460 D293E probably damaging Het
Sphk1 A G 11: 116,535,770 D177G probably damaging Het
Sphkap T G 1: 83,278,400 M543L probably benign Het
Syt13 A T 2: 92,953,415 K343N probably damaging Het
Tatdn3 A G 1: 191,060,176 M34T probably benign Het
Timd4 T G 11: 46,842,162 V305G possibly damaging Het
Tnnc2 T C 2: 164,777,592 I111V probably benign Het
Togaram2 C T 17: 71,697,851 P301L probably benign Het
Trpc3 T C 3: 36,640,627 N726S probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Ugt1a5 T A 1: 88,166,083 probably benign Het
Ulk3 A T 9: 57,593,160 probably null Het
Unc5d T A 8: 28,760,749 I297L probably benign Het
Usp20 A G 2: 31,018,818 I804V probably benign Het
Usp22 G T 11: 61,161,318 C278* probably null Het
Usp53 A T 3: 122,934,223 N903K probably benign Het
V1rd19 T C 7: 24,003,387 F93L probably benign Het
Zdbf2 T A 1: 63,304,334 V624E possibly damaging Het
Zfyve16 A T 13: 92,509,020 S1073T probably damaging Het
Zkscan8 T C 13: 21,526,595 H115R possibly damaging Het
Other mutations in Abca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Abca2 APN 2 25445963 splice site probably null
IGL01102:Abca2 APN 2 25433956 splice site probably benign
IGL01322:Abca2 APN 2 25446782 splice site probably null
IGL01402:Abca2 APN 2 25442003 missense probably damaging 1.00
IGL01419:Abca2 APN 2 25437514 missense probably damaging 1.00
IGL01490:Abca2 APN 2 25446011 missense probably damaging 1.00
IGL01633:Abca2 APN 2 25444394 missense possibly damaging 0.66
IGL01661:Abca2 APN 2 25442995 missense probably benign 0.01
IGL01804:Abca2 APN 2 25446625 missense probably damaging 1.00
IGL01933:Abca2 APN 2 25444111 missense probably damaging 1.00
IGL01941:Abca2 APN 2 25443095 missense probably benign 0.02
IGL02158:Abca2 APN 2 25447879 utr 3 prime probably benign
IGL02173:Abca2 APN 2 25441897 missense probably benign 0.00
IGL02419:Abca2 APN 2 25446837 missense probably benign
IGL02532:Abca2 APN 2 25435136 missense probably benign 0.03
IGL02572:Abca2 APN 2 25433317 missense possibly damaging 0.95
Abseiling UTSW 2 25447003 missense possibly damaging 0.65
R0126:Abca2 UTSW 2 25443730 missense possibly damaging 0.88
R0140:Abca2 UTSW 2 25438085 critical splice donor site probably null
R0372:Abca2 UTSW 2 25437353 missense probably damaging 1.00
R0437:Abca2 UTSW 2 25442845 missense probably damaging 0.99
R0505:Abca2 UTSW 2 25434894 missense probably benign 0.22
R0570:Abca2 UTSW 2 25447405 splice site probably null
R1037:Abca2 UTSW 2 25438228 splice site probably benign
R1283:Abca2 UTSW 2 25446689 missense probably damaging 1.00
R1448:Abca2 UTSW 2 25440530 missense possibly damaging 0.73
R1464:Abca2 UTSW 2 25447834 splice site probably benign
R1468:Abca2 UTSW 2 25441296 missense probably damaging 0.99
R1468:Abca2 UTSW 2 25441296 missense probably damaging 0.99
R1480:Abca2 UTSW 2 25433397 missense possibly damaging 0.60
R1545:Abca2 UTSW 2 25442358 missense probably benign 0.17
R1562:Abca2 UTSW 2 25446319 missense probably benign 0.43
R1569:Abca2 UTSW 2 25439185 missense probably benign 0.45
R1586:Abca2 UTSW 2 25447216 missense probably damaging 0.98
R1699:Abca2 UTSW 2 25447351 missense possibly damaging 0.80
R1754:Abca2 UTSW 2 25434333 missense probably benign 0.01
R1760:Abca2 UTSW 2 25443043 missense probably benign 0.00
R2040:Abca2 UTSW 2 25443805 missense probably damaging 1.00
R2067:Abca2 UTSW 2 25437505 missense possibly damaging 0.88
R2111:Abca2 UTSW 2 25437505 missense possibly damaging 0.88
R2248:Abca2 UTSW 2 25433464 splice site probably benign
R2323:Abca2 UTSW 2 25445175 missense probably benign 0.00
R2418:Abca2 UTSW 2 25437989 missense probably benign 0.22
R2419:Abca2 UTSW 2 25437989 missense probably benign 0.22
R3816:Abca2 UTSW 2 25446071 missense probably damaging 1.00
R4180:Abca2 UTSW 2 25441578 missense possibly damaging 0.58
R4431:Abca2 UTSW 2 25442852 missense probably benign
R4468:Abca2 UTSW 2 25444902 missense probably damaging 1.00
R4704:Abca2 UTSW 2 25443412 missense probably damaging 0.99
R4839:Abca2 UTSW 2 25440909 missense probably damaging 0.99
R4933:Abca2 UTSW 2 25444827 missense probably benign 0.25
R4970:Abca2 UTSW 2 25438371 missense probably damaging 1.00
R4971:Abca2 UTSW 2 25441994 missense probably damaging 0.97
R5112:Abca2 UTSW 2 25438371 missense probably damaging 1.00
R5327:Abca2 UTSW 2 25445674 missense probably damaging 1.00
R5378:Abca2 UTSW 2 25446068 missense probably damaging 1.00
R5648:Abca2 UTSW 2 25436498 critical splice donor site probably null
R5725:Abca2 UTSW 2 25439400 missense probably damaging 0.98
R5825:Abca2 UTSW 2 25436736 missense probably benign 0.36
R5837:Abca2 UTSW 2 25433359 missense probably benign 0.34
R5840:Abca2 UTSW 2 25433359 missense probably benign 0.34
R5851:Abca2 UTSW 2 25442310 missense possibly damaging 0.58
R6262:Abca2 UTSW 2 25444910 missense possibly damaging 0.56
R6344:Abca2 UTSW 2 25437694 missense probably damaging 1.00
R6547:Abca2 UTSW 2 25433338 missense possibly damaging 0.80
R6640:Abca2 UTSW 2 25447003 missense possibly damaging 0.65
R6980:Abca2 UTSW 2 25440866 missense possibly damaging 0.89
R6981:Abca2 UTSW 2 25444139 missense probably damaging 1.00
R7070:Abca2 UTSW 2 25442995 missense probably benign 0.06
R7080:Abca2 UTSW 2 25446104 missense not run
Predicted Primers PCR Primer
(F):5'- TCTTCATCGGCATCACAGCCAC -3'
(R):5'- CCACAGGTTTAGTAGACACAGGCAG -3'

Sequencing Primer
(F):5'- GCAGCTTTTTGAGCATGACAAG -3'
(R):5'- cacacacacacacacacac -3'
Posted On2014-04-24