Incidental Mutation 'R1635:Myo5c'
ID173084
Institutional Source Beutler Lab
Gene Symbol Myo5c
Ensembl Gene ENSMUSG00000033590
Gene Namemyosin VC
Synonyms9130003O20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R1635 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location75232020-75305451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75277075 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 949 (R949S)
Ref Sequence ENSEMBL: ENSMUSP00000042229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036555] [ENSMUST00000216788]
Predicted Effect probably benign
Transcript: ENSMUST00000036555
AA Change: R949S

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000042229
Gene: ENSMUSG00000033590
AA Change: R949S

DomainStartEndE-ValueType
MYSc 61 754 N/A SMART
IQ 755 777 1.11e-3 SMART
IQ 778 800 1.39e0 SMART
IQ 806 828 8.98e-4 SMART
IQ 829 851 4.19e-4 SMART
IQ 854 876 2.54e-3 SMART
coiled coil region 1160 1185 N/A INTRINSIC
coiled coil region 1207 1245 N/A INTRINSIC
DIL 1574 1679 5.54e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216788
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A T 2: 25,444,856 I1947F probably benign Het
Adgrd1 G T 5: 129,128,907 V182F probably damaging Het
Agmat A G 4: 141,747,069 D87G probably damaging Het
AI182371 T C 2: 35,088,737 probably null Het
Anapc1 G T 2: 128,628,532 H1559Q probably damaging Het
Ankar T C 1: 72,650,138 Y1278C probably damaging Het
Arhgef2 A T 3: 88,639,321 probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Banp A T 8: 122,001,011 I130F probably damaging Het
C130050O18Rik G T 5: 139,414,493 R100S probably benign Het
Carmil3 A G 14: 55,496,282 T374A possibly damaging Het
Cc2d2a T A 5: 43,722,470 W1076R probably damaging Het
Cdc34 T G 10: 79,688,054 S235A probably benign Het
Cdh8 G T 8: 99,031,024 H647Q probably damaging Het
Cdk1 A T 10: 69,338,547 L282Q probably damaging Het
Ceacam3 A G 7: 17,159,977 D471G probably damaging Het
Cltc A T 11: 86,757,279 I4N probably benign Het
Cntfr T A 4: 41,658,816 E305V probably damaging Het
Cwh43 T A 5: 73,434,310 I496N probably damaging Het
Cyp2f2 A G 7: 27,129,724 N218S probably benign Het
D16Ertd472e A G 16: 78,546,504 probably null Het
Dab2 A G 15: 6,429,870 Q400R possibly damaging Het
Dapl1 A T 2: 59,496,562 I51F probably benign Het
Drc7 G A 8: 95,074,332 probably null Het
Etl4 A G 2: 20,806,408 T1101A probably damaging Het
Fam83c C A 2: 155,830,051 R488M possibly damaging Het
Fam96b A T 8: 104,640,988 I108N possibly damaging Het
Fbxo42 A G 4: 141,200,529 T707A probably damaging Het
Fcmr A T 1: 130,876,185 probably null Het
Fer1l6 G C 15: 58,647,081 K1687N probably damaging Het
Fgd4 G A 16: 16,475,029 R275* probably null Het
Fxr2 G A 11: 69,641,313 C87Y possibly damaging Het
Gja4 A T 4: 127,312,679 I97N probably damaging Het
Gm136 A G 4: 34,750,919 probably null Het
Gm14496 A G 2: 182,001,044 D836G possibly damaging Het
Gm8882 A G 6: 132,363,006 probably null Het
Grm3 T A 5: 9,511,520 T777S probably damaging Het
Guca2b A G 4: 119,657,715 Y50H probably damaging Het
Herc2 C T 7: 56,136,667 P1587S probably benign Het
Hmcn1 C T 1: 150,669,558 S2766N probably benign Het
Idi2 T A 13: 8,959,419 I224K probably damaging Het
Kmt2a A T 9: 44,824,369 probably benign Het
Lonp2 A T 8: 86,713,450 M693L possibly damaging Het
Megf8 G T 7: 25,346,747 M1525I possibly damaging Het
Mgme1 T C 2: 144,279,098 V276A possibly damaging Het
Mief2 G T 11: 60,731,408 W268L probably damaging Het
Mpped1 C T 15: 83,791,990 probably benign Het
Mreg T C 1: 72,192,197 N34S probably benign Het
Myf6 T C 10: 107,494,673 Y11C probably damaging Het
Myh9 C A 15: 77,771,167 Q1196H probably benign Het
Myh9 A T 15: 77,775,899 D56E probably benign Het
Ncapg2 TAA TA 12: 116,434,685 probably null Het
Nfx1 T A 4: 40,977,004 V226E probably benign Het
Nlrp10 T A 7: 108,924,530 K581M possibly damaging Het
Nmd3 T G 3: 69,739,984 I273S probably benign Het
Olfr1264 A T 2: 90,021,970 I32N possibly damaging Het
P4hb T C 11: 120,571,616 E88G probably damaging Het
Pcnx3 A T 19: 5,665,745 H1444Q probably benign Het
Pdia4 A T 6: 47,799,199 F421L possibly damaging Het
Picalm T A 7: 90,191,251 S538T probably damaging Het
Ppp2r2b T A 18: 43,059,210 I11F probably benign Het
Ptk7 C T 17: 46,573,534 E757K possibly damaging Het
Rbm22 T G 18: 60,561,268 C24W probably damaging Het
Rev3l A G 10: 39,806,662 D288G probably damaging Het
Rgs18 T A 1: 144,754,053 H156L probably benign Het
Rnf213 A G 11: 119,442,579 I2871M probably damaging Het
Rrm2b A T 15: 37,945,084 M137K probably damaging Het
Rrp12 A T 19: 41,868,785 D1183E probably benign Het
Sacs G A 14: 61,203,828 V1108M probably damaging Het
Scube2 A T 7: 109,843,214 D270E possibly damaging Het
Serpina3a T A 12: 104,116,478 F170Y probably damaging Het
Serpinb3b T C 1: 107,154,673 E287G probably benign Het
Slamf8 C T 1: 172,584,619 V130M probably damaging Het
Slc5a3 T C 16: 92,077,396 S114P possibly damaging Het
Sos1 T A 17: 80,422,679 probably null Het
Sox10 A T 15: 79,156,460 D293E probably damaging Het
Sphk1 A G 11: 116,535,770 D177G probably damaging Het
Sphkap T G 1: 83,278,400 M543L probably benign Het
Syt13 A T 2: 92,953,415 K343N probably damaging Het
Tatdn3 A G 1: 191,060,176 M34T probably benign Het
Timd4 T G 11: 46,842,162 V305G possibly damaging Het
Tnnc2 T C 2: 164,777,592 I111V probably benign Het
Togaram2 C T 17: 71,697,851 P301L probably benign Het
Trpc3 T C 3: 36,640,627 N726S probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Ugt1a5 T A 1: 88,166,083 probably benign Het
Ulk3 A T 9: 57,593,160 probably null Het
Unc5d T A 8: 28,760,749 I297L probably benign Het
Usp20 A G 2: 31,018,818 I804V probably benign Het
Usp22 G T 11: 61,161,318 C278* probably null Het
Usp53 A T 3: 122,934,223 N903K probably benign Het
V1rd19 T C 7: 24,003,387 F93L probably benign Het
Zdbf2 T A 1: 63,304,334 V624E possibly damaging Het
Zfyve16 A T 13: 92,509,020 S1073T probably damaging Het
Zkscan8 T C 13: 21,526,595 H115R possibly damaging Het
Other mutations in Myo5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Myo5c APN 9 75242880 splice site probably benign
IGL00848:Myo5c APN 9 75289181 missense probably benign
IGL01503:Myo5c APN 9 75263042 missense probably damaging 1.00
IGL01735:Myo5c APN 9 75301438 missense probably damaging 1.00
IGL01866:Myo5c APN 9 75269582 missense probably benign 0.00
IGL01956:Myo5c APN 9 75242876 splice site probably null
IGL02127:Myo5c APN 9 75300902 missense probably damaging 1.00
IGL02268:Myo5c APN 9 75246237 missense probably damaging 1.00
IGL02272:Myo5c APN 9 75266160 missense possibly damaging 0.73
IGL03052:Myo5c APN 9 75252516 splice site probably benign
IGL03179:Myo5c APN 9 75255866 missense possibly damaging 0.65
IGL03224:Myo5c APN 9 75278243 missense probably benign 0.01
PIT4142001:Myo5c UTSW 9 75283948 missense probably benign 0.00
R0126:Myo5c UTSW 9 75269525 missense probably benign 0.05
R0266:Myo5c UTSW 9 75284216 splice site probably benign
R0345:Myo5c UTSW 9 75297419 missense probably damaging 1.00
R0387:Myo5c UTSW 9 75285021 splice site probably benign
R0602:Myo5c UTSW 9 75266196 splice site probably null
R0675:Myo5c UTSW 9 75278289 missense probably benign
R0798:Myo5c UTSW 9 75257984 missense probably damaging 1.00
R0981:Myo5c UTSW 9 75271591 missense probably damaging 1.00
R1051:Myo5c UTSW 9 75290883 missense probably benign 0.00
R1072:Myo5c UTSW 9 75292208 missense probably damaging 1.00
R1144:Myo5c UTSW 9 75286448 missense probably damaging 1.00
R1454:Myo5c UTSW 9 75263066 missense possibly damaging 0.94
R1476:Myo5c UTSW 9 75275939 missense probably damaging 1.00
R1484:Myo5c UTSW 9 75300810 missense probably damaging 1.00
R1586:Myo5c UTSW 9 75267031 missense probably damaging 0.99
R1616:Myo5c UTSW 9 75296017 missense probably damaging 1.00
R1800:Myo5c UTSW 9 75246164 missense probably damaging 1.00
R1838:Myo5c UTSW 9 75273553 missense probably damaging 1.00
R1840:Myo5c UTSW 9 75249735 missense probably damaging 1.00
R1885:Myo5c UTSW 9 75249761 missense probably damaging 1.00
R1897:Myo5c UTSW 9 75292241 missense probably benign 0.20
R1898:Myo5c UTSW 9 75297626 missense probably damaging 1.00
R2029:Myo5c UTSW 9 75289055 unclassified probably benign
R2063:Myo5c UTSW 9 75281868 missense probably benign 0.19
R2230:Myo5c UTSW 9 75273606 missense probably benign
R2519:Myo5c UTSW 9 75250436 missense probably damaging 1.00
R2520:Myo5c UTSW 9 75297649 nonsense probably null
R3034:Myo5c UTSW 9 75286577 missense probably benign 0.44
R3117:Myo5c UTSW 9 75266194 critical splice donor site probably null
R3432:Myo5c UTSW 9 75263001 missense probably damaging 1.00
R3751:Myo5c UTSW 9 75276002 missense probably damaging 1.00
R4132:Myo5c UTSW 9 75252568 missense probably benign 0.00
R4173:Myo5c UTSW 9 75246258 missense probably damaging 1.00
R4239:Myo5c UTSW 9 75283942 missense probably benign 0.01
R4429:Myo5c UTSW 9 75294001 missense probably damaging 1.00
R4574:Myo5c UTSW 9 75269611 missense probably benign 0.00
R4791:Myo5c UTSW 9 75290916 missense probably damaging 1.00
R4804:Myo5c UTSW 9 75245024 missense probably damaging 1.00
R4819:Myo5c UTSW 9 75292202 missense probably damaging 0.97
R4881:Myo5c UTSW 9 75284152 missense probably benign 0.00
R4900:Myo5c UTSW 9 75273543 missense probably damaging 1.00
R4964:Myo5c UTSW 9 75297509 missense possibly damaging 0.51
R4966:Myo5c UTSW 9 75269596 missense probably benign 0.03
R5057:Myo5c UTSW 9 75300873 missense probably damaging 1.00
R5347:Myo5c UTSW 9 75295205 missense probably null 1.00
R5399:Myo5c UTSW 9 75288074 missense possibly damaging 0.80
R5440:Myo5c UTSW 9 75258125 missense possibly damaging 0.91
R5569:Myo5c UTSW 9 75273510 missense probably damaging 1.00
R5600:Myo5c UTSW 9 75289154 missense probably benign 0.00
R5606:Myo5c UTSW 9 75275508 missense probably damaging 1.00
R5704:Myo5c UTSW 9 75272903 missense probably benign 0.00
R5798:Myo5c UTSW 9 75284198 missense probably benign 0.04
R5865:Myo5c UTSW 9 75297488 missense probably damaging 0.97
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6143:Myo5c UTSW 9 75249809 missense probably damaging 1.00
R6242:Myo5c UTSW 9 75273611 missense probably benign
R6253:Myo5c UTSW 9 75245037 missense probably damaging 1.00
R6264:Myo5c UTSW 9 75275554 missense probably benign
R6307:Myo5c UTSW 9 75272916 missense possibly damaging 0.73
R6358:Myo5c UTSW 9 75296012 missense possibly damaging 0.53
R6450:Myo5c UTSW 9 75286578 missense probably benign 0.26
R6598:Myo5c UTSW 9 75246234 missense probably damaging 1.00
R6618:Myo5c UTSW 9 75275637 critical splice donor site probably null
R6774:Myo5c UTSW 9 75289186 missense probably benign 0.05
R6865:Myo5c UTSW 9 75269596 missense probably benign 0.03
Z1088:Myo5c UTSW 9 75245059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCCGCGTCTTTCTCTAGAACAG -3'
(R):5'- CTCATGCAGGTGGACAAGTGACAG -3'

Sequencing Primer
(F):5'- TTCTCTAGAACAGAGAGAACCACG -3'
(R):5'- TCAGCTTGTAAAGGCGGAC -3'
Posted On2014-04-24