Incidental Mutation 'R1635:Tspear'
ID173087
Institutional Source Beutler Lab
Gene Symbol Tspear
Ensembl Gene ENSMUSG00000069581
Gene Namethrombospondin type laminin G domain and EAR repeats
SynonymsC330046G03Rik, ORF65
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R1635 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location77686569-77887021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77870419 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 341 (L341H)
Ref Sequence ENSEMBL: ENSMUSP00000090020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092366]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092366
AA Change: L341H

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090020
Gene: ENSMUSG00000069581
AA Change: L341H

DomainStartEndE-ValueType
Blast:TSPN 1 71 8e-40 BLAST
SCOP:d1c4ra_ 2 67 2e-7 SMART
low complexity region 190 200 N/A INTRINSIC
Pfam:EPTP 208 255 2.6e-22 PFAM
Pfam:EPTP 260 307 1.4e-21 PFAM
Pfam:EPTP 312 359 8.9e-14 PFAM
Pfam:EPTP 362 417 6.2e-13 PFAM
Pfam:EPTP 422 469 1.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000092368
SMART Domains Protein: ENSMUSP00000090022
Gene: ENSMUSG00000069581

DomainStartEndE-ValueType
TSPN 3 174 2.24e-5 SMART
LamG 34 173 1.09e-1 SMART
low complexity region 293 303 N/A INTRINSIC
Pfam:EPTP 311 357 3.4e-20 PFAM
Pfam:EPTP 362 409 4.9e-23 PFAM
Pfam:EPTP 414 461 3.1e-15 PFAM
Pfam:EPTP 464 519 2.2e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125241
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a N-terminal thrombospondin-type laminin G domain and several tandem arranged epilepsy-associated repeats (EARs). A mutation in this gene is the cause of autosomal recessive deafness-98. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A T 2: 25,444,856 I1947F probably benign Het
Adgrd1 G T 5: 129,128,907 V182F probably damaging Het
Agmat A G 4: 141,747,069 D87G probably damaging Het
AI182371 T C 2: 35,088,737 probably null Het
Anapc1 G T 2: 128,628,532 H1559Q probably damaging Het
Ankar T C 1: 72,650,138 Y1278C probably damaging Het
Arhgef2 A T 3: 88,639,321 probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Banp A T 8: 122,001,011 I130F probably damaging Het
C130050O18Rik G T 5: 139,414,493 R100S probably benign Het
Carmil3 A G 14: 55,496,282 T374A possibly damaging Het
Cc2d2a T A 5: 43,722,470 W1076R probably damaging Het
Cdc34 T G 10: 79,688,054 S235A probably benign Het
Cdh8 G T 8: 99,031,024 H647Q probably damaging Het
Cdk1 A T 10: 69,338,547 L282Q probably damaging Het
Ceacam3 A G 7: 17,159,977 D471G probably damaging Het
Cltc A T 11: 86,757,279 I4N probably benign Het
Cntfr T A 4: 41,658,816 E305V probably damaging Het
Cwh43 T A 5: 73,434,310 I496N probably damaging Het
Cyp2f2 A G 7: 27,129,724 N218S probably benign Het
D16Ertd472e A G 16: 78,546,504 probably null Het
Dab2 A G 15: 6,429,870 Q400R possibly damaging Het
Dapl1 A T 2: 59,496,562 I51F probably benign Het
Drc7 G A 8: 95,074,332 probably null Het
Etl4 A G 2: 20,806,408 T1101A probably damaging Het
Fam83c C A 2: 155,830,051 R488M possibly damaging Het
Fam96b A T 8: 104,640,988 I108N possibly damaging Het
Fbxo42 A G 4: 141,200,529 T707A probably damaging Het
Fcmr A T 1: 130,876,185 probably null Het
Fer1l6 G C 15: 58,647,081 K1687N probably damaging Het
Fgd4 G A 16: 16,475,029 R275* probably null Het
Fxr2 G A 11: 69,641,313 C87Y possibly damaging Het
Gja4 A T 4: 127,312,679 I97N probably damaging Het
Gm136 A G 4: 34,750,919 probably null Het
Gm14496 A G 2: 182,001,044 D836G possibly damaging Het
Gm8882 A G 6: 132,363,006 probably null Het
Grm3 T A 5: 9,511,520 T777S probably damaging Het
Guca2b A G 4: 119,657,715 Y50H probably damaging Het
Herc2 C T 7: 56,136,667 P1587S probably benign Het
Hmcn1 C T 1: 150,669,558 S2766N probably benign Het
Idi2 T A 13: 8,959,419 I224K probably damaging Het
Kmt2a A T 9: 44,824,369 probably benign Het
Lonp2 A T 8: 86,713,450 M693L possibly damaging Het
Megf8 G T 7: 25,346,747 M1525I possibly damaging Het
Mgme1 T C 2: 144,279,098 V276A possibly damaging Het
Mief2 G T 11: 60,731,408 W268L probably damaging Het
Mpped1 C T 15: 83,791,990 probably benign Het
Mreg T C 1: 72,192,197 N34S probably benign Het
Myf6 T C 10: 107,494,673 Y11C probably damaging Het
Myh9 C A 15: 77,771,167 Q1196H probably benign Het
Myh9 A T 15: 77,775,899 D56E probably benign Het
Myo5c A T 9: 75,277,075 R949S probably benign Het
Ncapg2 TAA TA 12: 116,434,685 probably null Het
Nfx1 T A 4: 40,977,004 V226E probably benign Het
Nlrp10 T A 7: 108,924,530 K581M possibly damaging Het
Nmd3 T G 3: 69,739,984 I273S probably benign Het
Olfr1264 A T 2: 90,021,970 I32N possibly damaging Het
P4hb T C 11: 120,571,616 E88G probably damaging Het
Pcnx3 A T 19: 5,665,745 H1444Q probably benign Het
Pdia4 A T 6: 47,799,199 F421L possibly damaging Het
Picalm T A 7: 90,191,251 S538T probably damaging Het
Ppp2r2b T A 18: 43,059,210 I11F probably benign Het
Ptk7 C T 17: 46,573,534 E757K possibly damaging Het
Rbm22 T G 18: 60,561,268 C24W probably damaging Het
Rev3l A G 10: 39,806,662 D288G probably damaging Het
Rgs18 T A 1: 144,754,053 H156L probably benign Het
Rnf213 A G 11: 119,442,579 I2871M probably damaging Het
Rrm2b A T 15: 37,945,084 M137K probably damaging Het
Rrp12 A T 19: 41,868,785 D1183E probably benign Het
Sacs G A 14: 61,203,828 V1108M probably damaging Het
Scube2 A T 7: 109,843,214 D270E possibly damaging Het
Serpina3a T A 12: 104,116,478 F170Y probably damaging Het
Serpinb3b T C 1: 107,154,673 E287G probably benign Het
Slamf8 C T 1: 172,584,619 V130M probably damaging Het
Slc5a3 T C 16: 92,077,396 S114P possibly damaging Het
Sos1 T A 17: 80,422,679 probably null Het
Sox10 A T 15: 79,156,460 D293E probably damaging Het
Sphk1 A G 11: 116,535,770 D177G probably damaging Het
Sphkap T G 1: 83,278,400 M543L probably benign Het
Syt13 A T 2: 92,953,415 K343N probably damaging Het
Tatdn3 A G 1: 191,060,176 M34T probably benign Het
Timd4 T G 11: 46,842,162 V305G possibly damaging Het
Tnnc2 T C 2: 164,777,592 I111V probably benign Het
Togaram2 C T 17: 71,697,851 P301L probably benign Het
Trpc3 T C 3: 36,640,627 N726S probably damaging Het
Ugt1a5 T A 1: 88,166,083 probably benign Het
Ulk3 A T 9: 57,593,160 probably null Het
Unc5d T A 8: 28,760,749 I297L probably benign Het
Usp20 A G 2: 31,018,818 I804V probably benign Het
Usp22 G T 11: 61,161,318 C278* probably null Het
Usp53 A T 3: 122,934,223 N903K probably benign Het
V1rd19 T C 7: 24,003,387 F93L probably benign Het
Zdbf2 T A 1: 63,304,334 V624E possibly damaging Het
Zfyve16 A T 13: 92,509,020 S1073T probably damaging Het
Zkscan8 T C 13: 21,526,595 H115R possibly damaging Het
Other mutations in Tspear
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Tspear APN 10 77873236 missense probably benign 0.30
IGL01726:Tspear APN 10 77881287 intron probably benign
IGL02244:Tspear APN 10 77852856 unclassified probably benign
IGL02393:Tspear APN 10 77836573 missense probably damaging 1.00
IGL02502:Tspear APN 10 77852958 intron probably benign
IGL02653:Tspear APN 10 77706965 utr 3 prime probably benign
IGL03345:Tspear APN 10 77874882 splice site probably null
R0058:Tspear UTSW 10 77869631 missense probably benign 0.07
R0058:Tspear UTSW 10 77869631 missense probably benign 0.07
R0542:Tspear UTSW 10 77881087 missense probably benign 0.14
R1384:Tspear UTSW 10 77866332 missense probably benign 0.44
R1467:Tspear UTSW 10 77881192 missense probably damaging 1.00
R1467:Tspear UTSW 10 77881192 missense probably damaging 1.00
R1545:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R1625:Tspear UTSW 10 77870499 missense probably benign 0.20
R1636:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R1637:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R1744:Tspear UTSW 10 77864884 unclassified probably null
R1749:Tspear UTSW 10 77869673 missense probably benign 0.00
R1768:Tspear UTSW 10 77875116 critical splice donor site probably null
R1774:Tspear UTSW 10 77873185 missense probably benign 0.01
R1791:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R1892:Tspear UTSW 10 77870474 missense probably benign 0.00
R2014:Tspear UTSW 10 77875120 splice site probably benign
R2108:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R2248:Tspear UTSW 10 77873269 missense probably damaging 1.00
R3038:Tspear UTSW 10 77886439 nonsense probably null
R4010:Tspear UTSW 10 77836476 intron probably benign
R4661:Tspear UTSW 10 77866329 missense probably benign 0.24
R4734:Tspear UTSW 10 77864695 missense probably damaging 0.99
R4789:Tspear UTSW 10 77866365 missense possibly damaging 0.63
R4804:Tspear UTSW 10 77776957 unclassified probably null
R4904:Tspear UTSW 10 77869655 missense possibly damaging 0.93
R4937:Tspear UTSW 10 77875043 missense probably damaging 0.98
R4956:Tspear UTSW 10 77864767 missense possibly damaging 0.86
R5590:Tspear UTSW 10 77870365 missense probably benign
R6344:Tspear UTSW 10 77875013 missense possibly damaging 0.95
R6629:Tspear UTSW 10 77870509 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGGAGCAGCATCCCTTTAATGAGC -3'
(R):5'- TTGACTTGCAGAGTGCGTAGGC -3'

Sequencing Primer
(F):5'- GCTCTGGGCATAGATAGGTC -3'
(R):5'- AGTGCGTAGGCAGTCCAAC -3'
Posted On2014-04-24