Incidental Mutation 'R1636:Ndn'
ID173164
Institutional Source Beutler Lab
Gene Symbol Ndn
Ensembl Gene ENSMUSG00000033585
Gene Namenecdin
SynonymsPeg6
MMRRC Submission 039672-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.721) question?
Stock #R1636 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location62346569-62350262 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 62348508 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 34 (P34L)
Ref Sequence ENSEMBL: ENSMUSP00000045369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038775]
Predicted Effect probably benign
Transcript: ENSMUST00000038775
AA Change: P34L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000045369
Gene: ENSMUSG00000033585
AA Change: P34L

DomainStartEndE-ValueType
low complexity region 85 106 N/A INTRINSIC
MAGE 109 279 5.95e-56 SMART
low complexity region 299 317 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207232
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 96% (85/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene is located in the Prader-Willi syndrome deletion region. It is an imprinted gene and is expressed exclusively from the paternal allele. Studies in mouse suggest that the protein encoded by this gene may suppress growth in postmitotic neurons. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial neonatal lethality, cyanosis and respiratory distress. Mice heterozygous for a knock-out allele exhibit abnormal behavior, abnormal nervous system morphology and physiology and, when inherited maternally, postnatal lethality with cyanosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C A 6: 121,654,612 L623M probably benign Het
Abca7 A G 10: 80,008,998 H1518R probably benign Het
Adam4 A G 12: 81,419,690 L719S probably damaging Het
Adprm T C 11: 67,041,723 Y120C possibly damaging Het
Arhgap25 T A 6: 87,495,941 Y78F probably damaging Het
Asap1 G A 15: 64,123,912 P665L probably damaging Het
Bank1 T C 3: 136,083,226 K637R probably damaging Het
BC005561 T A 5: 104,520,750 M1046K probably damaging Het
Bcr T A 10: 75,131,066 L502M probably damaging Het
Brwd1 A G 16: 96,059,641 L315P probably damaging Het
Btbd7 A T 12: 102,793,851 Y613N probably damaging Het
Cdca7l G A 12: 117,876,928 R395H probably damaging Het
Cftr T A 6: 18,226,157 I368K probably damaging Het
D6Wsu163e T C 6: 126,946,601 V150A possibly damaging Het
Ddx52 A G 11: 83,955,343 T470A probably damaging Het
Def6 A G 17: 28,223,918 E316G possibly damaging Het
Dip2a A T 10: 76,321,578 N64K probably benign Het
Dlgap4 G T 2: 156,746,077 E631* probably null Het
Dner T C 1: 84,585,330 K190E possibly damaging Het
Eif2b4 T A 5: 31,192,266 probably null Het
Eif3a A T 19: 60,781,905 D119E possibly damaging Het
Ercc2 C T 7: 19,387,124 T276M possibly damaging Het
Exoc1 A G 5: 76,568,118 K830R probably benign Het
F2r G T 13: 95,603,892 Y378* probably null Het
Fam186a G A 15: 99,941,658 T2235I unknown Het
Fmo3 T G 1: 162,954,425 K453T probably benign Het
Fzd3 A T 14: 65,253,106 D9E probably benign Het
Galns A G 8: 122,604,216 probably benign Het
Gm1818 T C 12: 48,555,767 noncoding transcript Het
Gm9955 C A 18: 24,709,230 probably benign Het
Immp2l T C 12: 41,703,687 V113A probably damaging Het
Iyd T A 10: 3,545,588 M82K possibly damaging Het
Kif21a A T 15: 90,984,805 probably benign Het
Lipf A G 19: 33,976,535 D342G probably damaging Het
Lmbrd1 C A 1: 24,746,930 Y435* probably null Het
Mpped1 C T 15: 83,791,990 probably benign Het
Mtrf1l A G 10: 5,813,265 S355P probably damaging Het
Neo1 T C 9: 58,913,277 S788G probably damaging Het
Nfx1 T G 4: 41,016,072 probably null Het
Nlrp4c T C 7: 6,066,738 V546A possibly damaging Het
Nwd2 G A 5: 63,807,557 V1495M probably damaging Het
Oaf T A 9: 43,239,324 I84F probably benign Het
Obscn A G 11: 59,122,637 F1153S probably damaging Het
Ofcc1 A T 13: 40,180,428 C396S possibly damaging Het
Olfr576 T G 7: 102,965,691 I197S possibly damaging Het
Olfr955 T C 9: 39,469,919 D269G probably benign Het
Omg A G 11: 79,502,340 S231P probably benign Het
Pdcl3 A G 1: 38,994,935 T53A possibly damaging Het
Pik3r2 A T 8: 70,771,898 H244Q probably benign Het
Pinx1 A T 14: 63,866,137 H55L probably damaging Het
Pwwp2b T A 7: 139,254,842 H66Q probably benign Het
Rell2 A G 18: 37,958,079 D99G probably damaging Het
Reln G A 5: 21,998,683 A1191V probably damaging Het
Rprm T C 2: 54,085,304 M1V probably null Het
Sav1 A C 12: 69,984,495 H84Q probably benign Het
Scamp5 T C 9: 57,451,409 D28G possibly damaging Het
Selenbp2 G A 3: 94,696,815 G9D probably damaging Het
Sh3tc2 T C 18: 61,989,721 W518R probably damaging Het
Slc10a6 A T 5: 103,629,146 N29K probably benign Het
Spindoc C A 19: 7,374,557 D142Y probably damaging Het
Spink12 T A 18: 44,107,728 D60E probably benign Het
Sugt1 A G 14: 79,587,982 I23V probably benign Het
Syne2 T C 12: 76,004,732 C4079R probably benign Het
Tex15 T G 8: 33,576,387 Y1948* probably null Het
Tln2 T C 9: 67,306,532 E321G probably damaging Het
Tmem198b A G 10: 128,802,196 L166P probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Ttn T A 2: 76,900,222 probably benign Het
Unc13a G A 8: 71,653,390 T690I probably damaging Het
Ush2a T C 1: 188,466,176 I1479T possibly damaging Het
Vcan G A 13: 89,703,667 T1058I possibly damaging Het
Vmn1r84 T C 7: 12,362,595 Q45R probably benign Het
Vmn2r111 T C 17: 22,571,399 N209D probably damaging Het
Wbp1l A G 19: 46,644,444 Y40C probably damaging Het
Wdr72 A T 9: 74,179,625 H625L probably benign Het
Zeb2 T C 2: 45,002,611 Y195C probably damaging Het
Zkscan6 C T 11: 65,814,430 probably benign Het
Zmym6 C A 4: 127,123,767 H1022N probably damaging Het
Other mutations in Ndn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01512:Ndn APN 7 62348733 missense probably damaging 1.00
IGL02332:Ndn APN 7 62348825 missense probably damaging 0.98
IGL02705:Ndn APN 7 62349108 missense probably damaging 0.99
IGL02824:Ndn APN 7 62348834 missense possibly damaging 0.83
R1525:Ndn UTSW 7 62348508 missense probably benign 0.00
R1595:Ndn UTSW 7 62348508 missense probably benign 0.00
R1598:Ndn UTSW 7 62348508 missense probably benign 0.00
R1638:Ndn UTSW 7 62348508 missense probably benign 0.00
R1653:Ndn UTSW 7 62348508 missense probably benign 0.00
R1791:Ndn UTSW 7 62348508 missense probably benign 0.00
R4674:Ndn UTSW 7 62348822 missense probably damaging 1.00
Z1088:Ndn UTSW 7 62349134 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCGCAGTGCTCAGTAAAGC -3'
(R):5'- CATGTCTGGAAACCAGAGGACCATC -3'

Sequencing Primer
(F):5'- GTGCTCAGTAAAGCGCACTTC -3'
(R):5'- TGGTCCTTCACCAACACG -3'
Posted On2014-04-24