Incidental Mutation 'R1636:Sh3tc2'
ID173212
Institutional Source Beutler Lab
Gene Symbol Sh3tc2
Ensembl Gene ENSMUSG00000045629
Gene NameSH3 domain and tetratricopeptide repeats 2
SynonymsD430044G18Rik
MMRRC Submission 039672-MU
Accession Numbers

Genbank: NM_172628

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1636 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location61953075-62015715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61989721 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 518 (W518R)
Ref Sequence ENSEMBL: ENSMUSP00000055094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051720]
Predicted Effect probably damaging
Transcript: ENSMUST00000051720
AA Change: W518R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055094
Gene: ENSMUSG00000045629
AA Change: W518R

DomainStartEndE-ValueType
coiled coil region 75 101 N/A INTRINSIC
SH3 179 238 1.02e0 SMART
SH3 270 329 6.76e-5 SMART
low complexity region 414 425 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 486 503 N/A INTRINSIC
TPR 529 562 3.24e1 SMART
low complexity region 568 581 N/A INTRINSIC
TPR 837 870 2.66e0 SMART
Blast:TPR 877 910 2e-7 BLAST
low complexity region 1011 1025 N/A INTRINSIC
Blast:TPR 1045 1078 1e-12 BLAST
Blast:TPR 1127 1158 3e-7 BLAST
TPR 1167 1200 1.04e-2 SMART
Blast:TPR 1211 1235 5e-7 BLAST
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 96% (85/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two N-terminal Src homology 3 (SH3) domains and 10 tetratricopeptide repeat (TPR) motifs, and is a member of a small gene family. The gene product has been proposed to be an adapter or docking molecule. Mutations in this gene result in autosomal recessive Charcot-Marie-Tooth disease type 4C, a childhood-onset neurodegenerative disease characterized by demyelination of motor and sensory neurons. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypomyelination of peripheral axons with reduced conduction velocity and limb grasping. [provided by MGI curators]
Allele List at MGI

 All alleles(3) : Targeted, other(3)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C A 6: 121,654,612 L623M probably benign Het
Abca7 A G 10: 80,008,998 H1518R probably benign Het
Adam4 A G 12: 81,419,690 L719S probably damaging Het
Adprm T C 11: 67,041,723 Y120C possibly damaging Het
Arhgap25 T A 6: 87,495,941 Y78F probably damaging Het
Asap1 G A 15: 64,123,912 P665L probably damaging Het
Bank1 T C 3: 136,083,226 K637R probably damaging Het
BC005561 T A 5: 104,520,750 M1046K probably damaging Het
Bcr T A 10: 75,131,066 L502M probably damaging Het
Brwd1 A G 16: 96,059,641 L315P probably damaging Het
Btbd7 A T 12: 102,793,851 Y613N probably damaging Het
Cdca7l G A 12: 117,876,928 R395H probably damaging Het
Cftr T A 6: 18,226,157 I368K probably damaging Het
D6Wsu163e T C 6: 126,946,601 V150A possibly damaging Het
Ddx52 A G 11: 83,955,343 T470A probably damaging Het
Def6 A G 17: 28,223,918 E316G possibly damaging Het
Dip2a A T 10: 76,321,578 N64K probably benign Het
Dlgap4 G T 2: 156,746,077 E631* probably null Het
Dner T C 1: 84,585,330 K190E possibly damaging Het
Eif2b4 T A 5: 31,192,266 probably null Het
Eif3a A T 19: 60,781,905 D119E possibly damaging Het
Ercc2 C T 7: 19,387,124 T276M possibly damaging Het
Exoc1 A G 5: 76,568,118 K830R probably benign Het
F2r G T 13: 95,603,892 Y378* probably null Het
Fam186a G A 15: 99,941,658 T2235I unknown Het
Fmo3 T G 1: 162,954,425 K453T probably benign Het
Fzd3 A T 14: 65,253,106 D9E probably benign Het
Galns A G 8: 122,604,216 probably benign Het
Gm1818 T C 12: 48,555,767 noncoding transcript Het
Gm9955 C A 18: 24,709,230 probably benign Het
Immp2l T C 12: 41,703,687 V113A probably damaging Het
Iyd T A 10: 3,545,588 M82K possibly damaging Het
Kif21a A T 15: 90,984,805 probably benign Het
Lipf A G 19: 33,976,535 D342G probably damaging Het
Lmbrd1 C A 1: 24,746,930 Y435* probably null Het
Mpped1 C T 15: 83,791,990 probably benign Het
Mtrf1l A G 10: 5,813,265 S355P probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Neo1 T C 9: 58,913,277 S788G probably damaging Het
Nfx1 T G 4: 41,016,072 probably null Het
Nlrp4c T C 7: 6,066,738 V546A possibly damaging Het
Nwd2 G A 5: 63,807,557 V1495M probably damaging Het
Oaf T A 9: 43,239,324 I84F probably benign Het
Obscn A G 11: 59,122,637 F1153S probably damaging Het
Ofcc1 A T 13: 40,180,428 C396S possibly damaging Het
Olfr576 T G 7: 102,965,691 I197S possibly damaging Het
Olfr955 T C 9: 39,469,919 D269G probably benign Het
Omg A G 11: 79,502,340 S231P probably benign Het
Pdcl3 A G 1: 38,994,935 T53A possibly damaging Het
Pik3r2 A T 8: 70,771,898 H244Q probably benign Het
Pinx1 A T 14: 63,866,137 H55L probably damaging Het
Pwwp2b T A 7: 139,254,842 H66Q probably benign Het
Rell2 A G 18: 37,958,079 D99G probably damaging Het
Reln G A 5: 21,998,683 A1191V probably damaging Het
Rprm T C 2: 54,085,304 M1V probably null Het
Sav1 A C 12: 69,984,495 H84Q probably benign Het
Scamp5 T C 9: 57,451,409 D28G possibly damaging Het
Selenbp2 G A 3: 94,696,815 G9D probably damaging Het
Slc10a6 A T 5: 103,629,146 N29K probably benign Het
Spindoc C A 19: 7,374,557 D142Y probably damaging Het
Spink12 T A 18: 44,107,728 D60E probably benign Het
Sugt1 A G 14: 79,587,982 I23V probably benign Het
Syne2 T C 12: 76,004,732 C4079R probably benign Het
Tex15 T G 8: 33,576,387 Y1948* probably null Het
Tln2 T C 9: 67,306,532 E321G probably damaging Het
Tmem198b A G 10: 128,802,196 L166P probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Ttn T A 2: 76,900,222 probably benign Het
Unc13a G A 8: 71,653,390 T690I probably damaging Het
Ush2a T C 1: 188,466,176 I1479T possibly damaging Het
Vcan G A 13: 89,703,667 T1058I possibly damaging Het
Vmn1r84 T C 7: 12,362,595 Q45R probably benign Het
Vmn2r111 T C 17: 22,571,399 N209D probably damaging Het
Wbp1l A G 19: 46,644,444 Y40C probably damaging Het
Wdr72 A T 9: 74,179,625 H625L probably benign Het
Zeb2 T C 2: 45,002,611 Y195C probably damaging Het
Zkscan6 C T 11: 65,814,430 probably benign Het
Zmym6 C A 4: 127,123,767 H1022N probably damaging Het
Other mutations in Sh3tc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Sh3tc2 APN 18 61989511 missense probably damaging 1.00
IGL01523:Sh3tc2 APN 18 61990883 missense probably benign 0.00
IGL02036:Sh3tc2 APN 18 62014907 missense probably benign 0.17
IGL02189:Sh3tc2 APN 18 61990622 missense probably benign 0.00
IGL02555:Sh3tc2 APN 18 61990237 missense probably damaging 0.99
IGL02827:Sh3tc2 APN 18 62013159 missense probably benign 0.34
IGL03033:Sh3tc2 APN 18 61974478 missense possibly damaging 0.90
IGL03040:Sh3tc2 APN 18 61989410 missense probably benign 0.00
IGL03062:Sh3tc2 APN 18 62011880 missense probably damaging 1.00
IGL03386:Sh3tc2 APN 18 61973311 missense probably benign 0.39
3-1:Sh3tc2 UTSW 18 61991138 missense probably damaging 1.00
R1085:Sh3tc2 UTSW 18 62014996 missense probably benign 0.01
R1166:Sh3tc2 UTSW 18 61991176 missense probably damaging 0.99
R1182:Sh3tc2 UTSW 18 61968100 missense probably benign 0.17
R1521:Sh3tc2 UTSW 18 62008488 missense probably damaging 0.96
R1872:Sh3tc2 UTSW 18 62011883 missense probably damaging 1.00
R1884:Sh3tc2 UTSW 18 62008575 missense probably damaging 1.00
R1964:Sh3tc2 UTSW 18 61991155 nonsense probably null
R2034:Sh3tc2 UTSW 18 61987666 missense probably damaging 1.00
R2046:Sh3tc2 UTSW 18 61990843 missense probably benign
R2113:Sh3tc2 UTSW 18 62013105 missense probably damaging 1.00
R2363:Sh3tc2 UTSW 18 61990895 missense probably benign 0.07
R2940:Sh3tc2 UTSW 18 61989686 missense probably damaging 1.00
R2979:Sh3tc2 UTSW 18 61989485 missense probably damaging 1.00
R3717:Sh3tc2 UTSW 18 61990343 missense probably benign 0.04
R3718:Sh3tc2 UTSW 18 61990343 missense probably benign 0.04
R4334:Sh3tc2 UTSW 18 61990321 missense probably damaging 1.00
R4454:Sh3tc2 UTSW 18 62007773 missense probably damaging 1.00
R4503:Sh3tc2 UTSW 18 61974623 missense probably damaging 0.96
R4515:Sh3tc2 UTSW 18 61987693 splice site probably null
R4659:Sh3tc2 UTSW 18 61974509 missense probably benign 0.00
R4859:Sh3tc2 UTSW 18 62013093 missense probably benign 0.00
R4901:Sh3tc2 UTSW 18 61990435 missense probably benign 0.03
R5033:Sh3tc2 UTSW 18 62014891 splice site probably null
R5269:Sh3tc2 UTSW 18 61975613 missense probably benign 0.00
R5439:Sh3tc2 UTSW 18 61989633 nonsense probably null
R5467:Sh3tc2 UTSW 18 61990688 missense possibly damaging 0.81
R5468:Sh3tc2 UTSW 18 61973431 critical splice donor site probably null
R5527:Sh3tc2 UTSW 18 62011861 missense probably benign 0.00
R5829:Sh3tc2 UTSW 18 61990915 missense probably benign 0.19
R5880:Sh3tc2 UTSW 18 61973311 missense probably benign 0.39
R5948:Sh3tc2 UTSW 18 62013105 missense probably damaging 1.00
R5951:Sh3tc2 UTSW 18 61990007 missense probably damaging 1.00
R5973:Sh3tc2 UTSW 18 61977904 missense probably benign 0.06
R5995:Sh3tc2 UTSW 18 61990010 missense probably damaging 0.96
R6309:Sh3tc2 UTSW 18 61968010 missense probably damaging 0.98
R6339:Sh3tc2 UTSW 18 61975571 nonsense probably null
R6648:Sh3tc2 UTSW 18 62015040 missense probably benign 0.00
R6723:Sh3tc2 UTSW 18 61977954 missense probably damaging 1.00
R6752:Sh3tc2 UTSW 18 61961037 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGATGATGTGGAGCACTTTGCCC -3'
(R):5'- TCTGCGAATGGCACAACTTCCTC -3'

Sequencing Primer
(F):5'- GAGCACTTTGCCCCCATC -3'
(R):5'- ACTGAACTCATGGTCTGGCAG -3'
Posted On2014-04-24