Incidental Mutation 'R1638:Elf2'
ID173288
Institutional Source Beutler Lab
Gene Symbol Elf2
Ensembl Gene ENSMUSG00000037174
Gene NameE74-like factor 2
Synonyms2610036A20Rik, A230104O07Rik, NERF-2
MMRRC Submission 039674-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.300) question?
Stock #R1638 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location51252720-51340663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 51308109 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 60 (T60I)
Ref Sequence ENSEMBL: ENSMUSP00000141197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062009] [ENSMUST00000091144] [ENSMUST00000163748] [ENSMUST00000183338] [ENSMUST00000183463] [ENSMUST00000194641]
Predicted Effect probably damaging
Transcript: ENSMUST00000062009
AA Change: T60I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061076
Gene: ENSMUSG00000037174
AA Change: T60I

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 108 2.2e-37 PFAM
low complexity region 130 142 N/A INTRINSIC
low complexity region 160 169 N/A INTRINSIC
ETS 195 282 1.28e-51 SMART
low complexity region 357 379 N/A INTRINSIC
low complexity region 411 421 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091144
AA Change: T60I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088678
Gene: ENSMUSG00000037174
AA Change: T60I

DomainStartEndE-ValueType
Pfam:Elf-1_N 3 108 8.6e-38 PFAM
low complexity region 142 154 N/A INTRINSIC
low complexity region 172 181 N/A INTRINSIC
ETS 207 294 1.28e-51 SMART
low complexity region 369 391 N/A INTRINSIC
low complexity region 423 433 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163748
AA Change: T60I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126871
Gene: ENSMUSG00000037174
AA Change: T60I

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 108 1.2e-37 PFAM
low complexity region 142 154 N/A INTRINSIC
low complexity region 172 181 N/A INTRINSIC
ETS 207 294 1.28e-51 SMART
low complexity region 369 391 N/A INTRINSIC
low complexity region 423 433 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183338
AA Change: T60I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139358
Gene: ENSMUSG00000037174
AA Change: T60I

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 80 3.2e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183463
AA Change: T60I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139360
Gene: ENSMUSG00000037174
AA Change: T60I

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 85 2.2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194209
Predicted Effect probably damaging
Transcript: ENSMUST00000194641
AA Change: T60I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141197
Gene: ENSMUSG00000037174
AA Change: T60I

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 108 1.2e-37 PFAM
low complexity region 142 154 N/A INTRINSIC
low complexity region 172 181 N/A INTRINSIC
ETS 207 294 1.28e-51 SMART
low complexity region 369 391 N/A INTRINSIC
low complexity region 423 433 N/A INTRINSIC
Meta Mutation Damage Score 0.17 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 87.8%
Validation Efficiency 99% (79/80)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,035,812 R4130* probably null Het
A2m C A 6: 121,654,612 L623M probably benign Het
Adamts13 A G 2: 26,996,583 E938G possibly damaging Het
Agfg1 A T 1: 82,893,538 Q497L probably damaging Het
Ahnak A G 19: 9,009,449 H2699R probably benign Het
Antxrl G T 14: 34,070,496 probably null Het
Apol7c A T 15: 77,526,218 V176E probably damaging Het
Arid5b T C 10: 68,277,947 N87D possibly damaging Het
Atp2c1 A T 9: 105,432,698 I560N probably damaging Het
Atp2c2 T C 8: 119,756,003 F868S possibly damaging Het
Blnk G C 19: 40,937,678 F326L probably benign Het
Ckap2 C T 8: 22,175,796 V412I possibly damaging Het
Clmn A G 12: 104,782,022 V422A probably benign Het
Ctnnal1 A G 4: 56,813,856 S638P probably benign Het
Cyp2j5 T C 4: 96,635,815 S327G probably benign Het
Dhx38 G A 8: 109,553,545 T871M probably damaging Het
Dmxl1 A T 18: 49,890,767 K1706* probably null Het
Dnah11 A G 12: 118,015,419 L2648P possibly damaging Het
Fam120b T A 17: 15,402,497 C246S possibly damaging Het
Fcho2 G T 13: 98,745,895 T451K possibly damaging Het
Fzd9 T A 5: 135,249,748 I428F probably damaging Het
Galnt13 T A 2: 54,854,655 V122E probably damaging Het
Gm21738 T A 14: 19,418,908 Y8F probably benign Het
Gnptab A G 10: 88,436,167 I940V possibly damaging Het
Gp2 A G 7: 119,451,498 probably null Het
Gpr6 A G 10: 41,070,534 S351P probably benign Het
Gprin1 T C 13: 54,739,876 E195G possibly damaging Het
Grm8 A T 6: 28,125,883 Y81* probably null Het
Gtf3c3 A T 1: 54,405,119 N703K probably damaging Het
H2afy T A 13: 56,104,909 N87Y probably damaging Het
Hhipl2 G A 1: 183,428,013 V495I probably benign Het
Islr G A 9: 58,158,219 probably benign Het
Lrrc36 T C 8: 105,449,641 Y216H possibly damaging Het
Me2 A G 18: 73,773,134 I528T probably benign Het
Mecr A T 4: 131,857,816 I156F possibly damaging Het
Megf6 A G 4: 154,262,510 probably benign Het
Mn1 T A 5: 111,421,569 L1135H probably damaging Het
Naip5 A G 13: 100,212,669 S1384P probably damaging Het
Nav2 A G 7: 49,452,465 N337S probably benign Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Neb A T 2: 52,249,281 H3107Q probably benign Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Nsd2 G A 5: 33,882,120 R825Q possibly damaging Het
Nsun2 A G 13: 69,627,586 N383S probably damaging Het
Ntrk3 A T 7: 78,247,288 M667K probably damaging Het
Olfr389 A G 11: 73,777,148 Y60H possibly damaging Het
Olfr514 A C 7: 108,825,235 C255G probably benign Het
Olfr745 G A 14: 50,643,108 V276M possibly damaging Het
Olfr791 A T 10: 129,526,619 M131L probably benign Het
Pex6 T C 17: 46,722,632 V633A probably benign Het
Phactr1 C T 13: 42,956,671 T95M probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Pkhd1l1 A C 15: 44,597,117 I4241L probably benign Het
Ppwd1 T C 13: 104,220,263 E248G probably damaging Het
Prepl A C 17: 85,072,081 M393R probably benign Het
Ptpn6 T C 6: 124,721,185 S532G probably benign Het
Rnase11 G T 14: 51,049,601 H165Q possibly damaging Het
Sf1 A G 19: 6,372,060 N172S possibly damaging Het
Shprh T A 10: 11,157,078 D269E probably benign Het
Slc16a1 T C 3: 104,649,482 I61T possibly damaging Het
Slc38a2 A C 15: 96,692,536 I309S probably damaging Het
Sry C G Y: 2,663,149 Q170H unknown Het
Stk3 A C 15: 35,008,308 probably null Het
Tg C A 15: 66,696,166 C1306* probably null Het
Tnik A G 3: 28,665,740 M1254V probably damaging Het
U2surp T C 9: 95,484,227 E474G possibly damaging Het
Vmn1r224 T A 17: 20,419,325 F55I probably benign Het
Vmn1r32 A G 6: 66,552,955 I279T possibly damaging Het
Zc2hc1a A G 3: 7,516,483 D15G probably benign Het
Zfp827 C A 8: 79,076,346 P516T possibly damaging Het
Zfyve9 A T 4: 108,684,907 probably null Het
Other mutations in Elf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Elf2 APN 3 51308046 critical splice donor site probably benign 0.00
IGL01577:Elf2 APN 3 51256352 utr 3 prime probably benign
IGL01829:Elf2 APN 3 51308100 missense probably damaging 0.98
IGL02974:Elf2 APN 3 51257689 missense probably damaging 0.98
IGL03244:Elf2 APN 3 51257772 nonsense probably null
IGL02980:Elf2 UTSW 3 51264958 missense possibly damaging 0.89
IGL03050:Elf2 UTSW 3 51257617 missense probably benign 0.05
R0254:Elf2 UTSW 3 51308190 missense probably damaging 1.00
R0594:Elf2 UTSW 3 51256453 missense possibly damaging 0.64
R0644:Elf2 UTSW 3 51308131 missense probably damaging 1.00
R1729:Elf2 UTSW 3 51257572 missense probably damaging 0.97
R1784:Elf2 UTSW 3 51257572 missense probably damaging 0.97
R2142:Elf2 UTSW 3 51256440 missense probably damaging 1.00
R2346:Elf2 UTSW 3 51257444 missense probably benign
R4366:Elf2 UTSW 3 51308149 nonsense probably null
R4672:Elf2 UTSW 3 51256434 missense probably damaging 1.00
R4834:Elf2 UTSW 3 51277221 missense probably damaging 1.00
R5514:Elf2 UTSW 3 51308134 missense probably damaging 1.00
R6198:Elf2 UTSW 3 51277249 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTCCAGCAATGCTGATTCAAAG -3'
(R):5'- TGAAGCCGAGTCACAGCTAAATCC -3'

Sequencing Primer
(F):5'- gctgctcttccagaggac -3'
(R):5'- GTCACAGCTAAATCCAGAGTTGTC -3'
Posted On2014-04-24