Incidental Mutation 'R1638:Slc16a1'
ID173289
Institutional Source Beutler Lab
Gene Symbol Slc16a1
Ensembl Gene ENSMUSG00000032902
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 1
SynonymsMCT1
MMRRC Submission 039674-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1638 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location104638668-104658462 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104649482 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 61 (I61T)
Ref Sequence ENSEMBL: ENSMUSP00000045216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046212]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046212
AA Change: I61T

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045216
Gene: ENSMUSG00000032902
AA Change: I61T

DomainStartEndE-ValueType
Pfam:MFS_1 17 399 3e-33 PFAM
Pfam:MFS_1 325 480 1.6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199375
Meta Mutation Damage Score 0.426 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 87.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a proton-linked monocarboxylate transporter that catalyzes the movement of many monocarboxylates, such as lactate and pyruvate, across the plasma membrane. Mutations in this gene are associated with erythrocyte lactate transporter defect. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes are non-viable, while heterozygous animals are resistant to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,035,812 R4130* probably null Het
A2m C A 6: 121,654,612 L623M probably benign Het
Adamts13 A G 2: 26,996,583 E938G possibly damaging Het
Agfg1 A T 1: 82,893,538 Q497L probably damaging Het
Ahnak A G 19: 9,009,449 H2699R probably benign Het
Antxrl G T 14: 34,070,496 probably null Het
Apol7c A T 15: 77,526,218 V176E probably damaging Het
Arid5b T C 10: 68,277,947 N87D possibly damaging Het
Atp2c1 A T 9: 105,432,698 I560N probably damaging Het
Atp2c2 T C 8: 119,756,003 F868S possibly damaging Het
Blnk G C 19: 40,937,678 F326L probably benign Het
Ckap2 C T 8: 22,175,796 V412I possibly damaging Het
Clmn A G 12: 104,782,022 V422A probably benign Het
Ctnnal1 A G 4: 56,813,856 S638P probably benign Het
Cyp2j5 T C 4: 96,635,815 S327G probably benign Het
Dhx38 G A 8: 109,553,545 T871M probably damaging Het
Dmxl1 A T 18: 49,890,767 K1706* probably null Het
Dnah11 A G 12: 118,015,419 L2648P possibly damaging Het
Elf2 G A 3: 51,308,109 T60I probably damaging Het
Fam120b T A 17: 15,402,497 C246S possibly damaging Het
Fcho2 G T 13: 98,745,895 T451K possibly damaging Het
Fzd9 T A 5: 135,249,748 I428F probably damaging Het
Galnt13 T A 2: 54,854,655 V122E probably damaging Het
Gm21738 T A 14: 19,418,908 Y8F probably benign Het
Gnptab A G 10: 88,436,167 I940V possibly damaging Het
Gp2 A G 7: 119,451,498 probably null Het
Gpr6 A G 10: 41,070,534 S351P probably benign Het
Gprin1 T C 13: 54,739,876 E195G possibly damaging Het
Grm8 A T 6: 28,125,883 Y81* probably null Het
Gtf3c3 A T 1: 54,405,119 N703K probably damaging Het
H2afy T A 13: 56,104,909 N87Y probably damaging Het
Hhipl2 G A 1: 183,428,013 V495I probably benign Het
Islr G A 9: 58,158,219 probably benign Het
Lrrc36 T C 8: 105,449,641 Y216H possibly damaging Het
Me2 A G 18: 73,773,134 I528T probably benign Het
Mecr A T 4: 131,857,816 I156F possibly damaging Het
Megf6 A G 4: 154,262,510 probably benign Het
Mn1 T A 5: 111,421,569 L1135H probably damaging Het
Naip5 A G 13: 100,212,669 S1384P probably damaging Het
Nav2 A G 7: 49,452,465 N337S probably benign Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Neb A T 2: 52,249,281 H3107Q probably benign Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Nsd2 G A 5: 33,882,120 R825Q possibly damaging Het
Nsun2 A G 13: 69,627,586 N383S probably damaging Het
Ntrk3 A T 7: 78,247,288 M667K probably damaging Het
Olfr389 A G 11: 73,777,148 Y60H possibly damaging Het
Olfr514 A C 7: 108,825,235 C255G probably benign Het
Olfr745 G A 14: 50,643,108 V276M possibly damaging Het
Olfr791 A T 10: 129,526,619 M131L probably benign Het
Pex6 T C 17: 46,722,632 V633A probably benign Het
Phactr1 C T 13: 42,956,671 T95M probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Pkhd1l1 A C 15: 44,597,117 I4241L probably benign Het
Ppwd1 T C 13: 104,220,263 E248G probably damaging Het
Prepl A C 17: 85,072,081 M393R probably benign Het
Ptpn6 T C 6: 124,721,185 S532G probably benign Het
Rnase11 G T 14: 51,049,601 H165Q possibly damaging Het
Sf1 A G 19: 6,372,060 N172S possibly damaging Het
Shprh T A 10: 11,157,078 D269E probably benign Het
Slc38a2 A C 15: 96,692,536 I309S probably damaging Het
Sry C G Y: 2,663,149 Q170H unknown Het
Stk3 A C 15: 35,008,308 probably null Het
Tg C A 15: 66,696,166 C1306* probably null Het
Tnik A G 3: 28,665,740 M1254V probably damaging Het
U2surp T C 9: 95,484,227 E474G possibly damaging Het
Vmn1r224 T A 17: 20,419,325 F55I probably benign Het
Vmn1r32 A G 6: 66,552,955 I279T possibly damaging Het
Zc2hc1a A G 3: 7,516,483 D15G probably benign Het
Zfp827 C A 8: 79,076,346 P516T possibly damaging Het
Zfyve9 A T 4: 108,684,907 probably null Het
Other mutations in Slc16a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0432:Slc16a1 UTSW 3 104653419 missense probably benign 0.00
R0532:Slc16a1 UTSW 3 104653418 nonsense probably null
R1826:Slc16a1 UTSW 3 104650939 missense probably benign 0.22
R1900:Slc16a1 UTSW 3 104653564 missense probably damaging 0.97
R1964:Slc16a1 UTSW 3 104649466 missense probably damaging 1.00
R3615:Slc16a1 UTSW 3 104653570 missense probably damaging 1.00
R3616:Slc16a1 UTSW 3 104653570 missense probably damaging 1.00
R4485:Slc16a1 UTSW 3 104655478 missense probably benign 0.13
R4772:Slc16a1 UTSW 3 104653564 missense possibly damaging 0.80
R6106:Slc16a1 UTSW 3 104652994 missense probably benign
R6123:Slc16a1 UTSW 3 104653194 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAGGTTTGTTGCTCCCCTTGC -3'
(R):5'- AGCTGCCAGTGTTGTCAGAGATG -3'

Sequencing Primer
(F):5'- CAGATACTAGATTTGCGCTGC -3'
(R):5'- TCAGAGATGAAAAGCACGCTTAATAC -3'
Posted On2014-04-24