Incidental Mutation 'R1639:Gpsm1'
ID173352
Institutional Source Beutler Lab
Gene Symbol Gpsm1
Ensembl Gene ENSMUSG00000026930
Gene NameG-protein signalling modulator 1 (AGS3-like, C. elegans)
SynonymsAgs3, 1810037C22Rik
MMRRC Submission 039675-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1639 (G1)
Quality Score175
Status Validated
Chromosome2
Chromosomal Location26315515-26348237 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26345187 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 371 (E371G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028295] [ENSMUST00000066889] [ENSMUST00000066936] [ENSMUST00000078616] [ENSMUST00000114134] [ENSMUST00000127453]
Predicted Effect probably benign
Transcript: ENSMUST00000028295
SMART Domains Protein: ENSMUSP00000028295
Gene: ENSMUSG00000075467

DomainStartEndE-ValueType
low complexity region 38 67 N/A INTRINSIC
Pfam:zf-DNL 74 139 4.1e-34 PFAM
low complexity region 158 172 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066889
AA Change: E580G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000067964
Gene: ENSMUSG00000026930
AA Change: E580G

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
TPR 98 131 1.45e-1 SMART
TPR 138 171 7.06e-5 SMART
TPR 238 271 5.96e-3 SMART
TPR 278 311 1.47e-2 SMART
TPR 318 351 5.19e-3 SMART
TPR 358 391 1.33e0 SMART
GoLoco 525 547 7.38e-9 SMART
low complexity region 548 560 N/A INTRINSIC
GoLoco 578 600 4.24e-9 SMART
GoLoco 626 648 5.22e-9 SMART
GoLoco 660 682 3.58e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000066936
AA Change: E548G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065000
Gene: ENSMUSG00000026930
AA Change: E548G

DomainStartEndE-ValueType
TPR 66 99 1.45e-1 SMART
TPR 106 139 7.06e-5 SMART
TPR 206 239 5.96e-3 SMART
TPR 246 279 1.47e-2 SMART
TPR 286 319 5.19e-3 SMART
TPR 326 359 1.33e0 SMART
GoLoco 493 515 7.38e-9 SMART
low complexity region 516 528 N/A INTRINSIC
GoLoco 546 568 4.24e-9 SMART
GoLoco 594 616 5.22e-9 SMART
GoLoco 628 650 3.58e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000078616
AA Change: E488G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077686
Gene: ENSMUSG00000026930
AA Change: E488G

DomainStartEndE-ValueType
TPR 66 99 1.45e-1 SMART
TPR 106 139 7.06e-5 SMART
TPR 206 239 5.96e-3 SMART
TPR 246 279 1.47e-2 SMART
TPR 286 319 5.19e-3 SMART
TPR 326 359 1.33e0 SMART
GoLoco 433 455 7.38e-9 SMART
low complexity region 456 468 N/A INTRINSIC
GoLoco 486 508 4.24e-9 SMART
GoLoco 534 556 5.22e-9 SMART
GoLoco 568 590 3.58e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114134
AA Change: E111G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109769
Gene: ENSMUSG00000026930
AA Change: E111G

DomainStartEndE-ValueType
GoLoco 56 78 7.38e-9 SMART
low complexity region 79 91 N/A INTRINSIC
GoLoco 109 131 4.24e-9 SMART
GoLoco 157 179 5.22e-9 SMART
GoLoco 191 213 3.58e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125848
Predicted Effect probably benign
Transcript: ENSMUST00000127453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142057
Predicted Effect probably damaging
Transcript: ENSMUST00000145884
AA Change: E371G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115680
Gene: ENSMUSG00000026930
AA Change: E371G

DomainStartEndE-ValueType
Blast:TPR 22 68 1e-9 BLAST
Pfam:TPR_1 82 107 2.3e-4 PFAM
Pfam:TPR_12 82 147 7.9e-12 PFAM
Pfam:TPR_7 84 119 1.4e-5 PFAM
Pfam:TPR_2 122 147 6.2e-4 PFAM
Pfam:TPR_8 123 146 1.4e-2 PFAM
Blast:TPR 150 183 4e-15 BLAST
GoLoco 317 339 7.38e-9 SMART
low complexity region 340 352 N/A INTRINSIC
GoLoco 370 392 4.24e-9 SMART
GoLoco 418 440 5.22e-9 SMART
GoLoco 452 474 3.58e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147873
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152895
Meta Mutation Damage Score 0.342 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] G-protein signaling modulators (GPSMs) play diverse functional roles through their interaction with G-protein subunits. This gene encodes a receptor-independent activator of G protein signaling, which is one of several factors that influence the basal activity of G-protein signaling systems. The protein contains seven tetratricopeptide repeats in its N-terminal half and four G-protein regulatory (GPR) motifs in its C-terminal half. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a lean phenotype, reduced fat mass, increased food consumption, increased nocturnal energy expenditure and altered blood pressure control mechanisms; surprisingly, their basal behavior and gross brain morphology remain normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik T C 13: 34,944,250 I150T possibly damaging Het
Acss2 C A 2: 155,556,908 T425N probably benign Het
Adam18 T A 8: 24,652,152 I203L probably benign Het
Amigo2 A G 15: 97,245,998 M181T probably benign Het
Anks1 T A 17: 28,058,306 I1045N probably damaging Het
Ap3d1 C T 10: 80,730,010 V108I probably damaging Het
Arl8a C T 1: 135,152,823 R57* probably null Het
Atp12a A T 14: 56,384,068 D720V possibly damaging Het
Brpf3 T C 17: 28,824,068 probably null Het
C2 T C 17: 34,872,403 K95E probably benign Het
Cdk19 T C 10: 40,476,969 probably null Het
Cebpz T A 17: 78,934,606 I540L possibly damaging Het
Cep128 A G 12: 91,366,368 V41A probably damaging Het
Cog7 T C 7: 121,981,419 E56G probably damaging Het
Cylc2 T C 4: 51,228,310 V127A probably benign Het
Cyp2b23 A G 7: 26,686,417 V5A possibly damaging Het
Cyp8b1 A G 9: 121,914,890 Y459H probably benign Het
Dbpht2 A G 12: 74,299,158 noncoding transcript Het
Ddx24 T C 12: 103,411,319 probably null Het
Dgki C T 6: 36,937,364 C757Y probably damaging Het
Eef2k T A 7: 120,885,828 L306H probably damaging Het
Ephb2 T C 4: 136,693,905 N378S probably benign Het
Espl1 C T 15: 102,320,714 T1767I probably damaging Het
Fbn2 C A 18: 58,058,462 A1530S probably benign Het
Fndc11 A G 2: 181,221,581 S60G possibly damaging Het
Glb1l G T 1: 75,199,601 Q612K probably benign Het
Gtpbp2 G A 17: 46,165,771 probably null Het
Itch A G 2: 155,179,025 probably null Het
Itga2 T C 13: 114,857,296 T774A probably benign Het
Kit A G 5: 75,652,807 I881V probably damaging Het
Lpar5 T C 6: 125,081,601 L95P probably damaging Het
Lrp6 T C 6: 134,453,566 T1511A possibly damaging Het
Mgat4c T C 10: 102,378,281 Y42H probably damaging Het
Mpp3 G T 11: 102,023,442 T109K probably damaging Het
Msantd4 A G 9: 4,385,199 E308G probably damaging Het
Mug1 T C 6: 121,880,571 S1085P probably damaging Het
Myo5b A G 18: 74,707,916 H956R probably benign Het
Ncoa7 A C 10: 30,701,992 L132R probably damaging Het
Ndufc1 T C 3: 51,408,243 T25A probably benign Het
Olfr1254 T C 2: 89,789,245 T36A probably damaging Het
Pkhd1l1 G A 15: 44,540,955 V2327M probably damaging Het
Ppp1r9b T C 11: 94,996,610 Y59H probably damaging Het
Sema4c A T 1: 36,553,534 F152I probably benign Het
Slit2 A T 5: 48,259,654 Y1016F probably damaging Het
Spata31d1c T A 13: 65,036,039 V465D probably benign Het
Ssc5d T C 7: 4,928,417 C208R probably damaging Het
Stambpl1 T G 19: 34,236,307 V312G probably benign Het
Stim1 T A 7: 102,354,541 D60E probably benign Het
Syt13 T A 2: 92,945,971 V201D probably benign Het
Tcaim G A 9: 122,818,773 probably null Het
Tex15 T C 8: 33,570,817 S366P possibly damaging Het
Tpte G A 8: 22,320,897 R190H probably benign Het
Vmn1r4 T C 6: 56,957,075 V188A probably damaging Het
Vmn2r88 A G 14: 51,416,787 D542G probably damaging Het
Vps33b T A 7: 80,284,353 I257N probably damaging Het
Wwox G T 8: 114,445,378 G71* probably null Het
Zc3h11a G T 1: 133,624,708 Q554K probably benign Het
Zfp947 T C 17: 22,146,093 K200R probably benign Het
Zscan12 T A 13: 21,368,986 C327S probably damaging Het
Other mutations in Gpsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01803:Gpsm1 APN 2 26346909 missense probably damaging 1.00
IGL01826:Gpsm1 APN 2 26326302 missense probably damaging 0.98
IGL02281:Gpsm1 APN 2 26339626 splice site probably benign
IGL02730:Gpsm1 APN 2 26325378 missense probably benign 0.13
IGL02740:Gpsm1 APN 2 26340573 missense probably benign 0.43
IGL02749:Gpsm1 APN 2 26339675 missense probably damaging 0.99
IGL02982:Gpsm1 APN 2 26324859 missense probably damaging 1.00
R1271:Gpsm1 UTSW 2 26344672 missense probably damaging 0.99
R1766:Gpsm1 UTSW 2 26325383 missense probably damaging 1.00
R1854:Gpsm1 UTSW 2 26344713 missense probably damaging 1.00
R2900:Gpsm1 UTSW 2 26345162 missense probably benign 0.00
R2994:Gpsm1 UTSW 2 26319831 unclassified probably benign
R2995:Gpsm1 UTSW 2 26319831 unclassified probably benign
R2996:Gpsm1 UTSW 2 26319831 unclassified probably benign
R4227:Gpsm1 UTSW 2 26339626 splice site probably benign
R4391:Gpsm1 UTSW 2 26323997 missense probably damaging 1.00
R4413:Gpsm1 UTSW 2 26319831 unclassified probably benign
R4461:Gpsm1 UTSW 2 26319831 unclassified probably benign
R4469:Gpsm1 UTSW 2 26319831 unclassified probably benign
R4659:Gpsm1 UTSW 2 26319831 unclassified probably benign
R4786:Gpsm1 UTSW 2 26322481 missense probably benign 0.01
R5025:Gpsm1 UTSW 2 26319996 missense possibly damaging 0.90
R5057:Gpsm1 UTSW 2 26325357 missense probably damaging 0.96
R5171:Gpsm1 UTSW 2 26327464 intron probably benign
R5356:Gpsm1 UTSW 2 26340562 missense possibly damaging 0.73
R5417:Gpsm1 UTSW 2 26324033 critical splice donor site probably null
R5967:Gpsm1 UTSW 2 26340534 unclassified probably null
R6153:Gpsm1 UTSW 2 26325413 missense probably benign 0.14
R6969:Gpsm1 UTSW 2 26340543 missense probably benign 0.01
R7006:Gpsm1 UTSW 2 26322560 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGAAGTGTCTATGCATCCCAGCC -3'
(R):5'- AAGCTCCACCCATTGCCTTCTGAG -3'

Sequencing Primer
(F):5'- ATCCCAGCCTTTGAGTGTG -3'
(R):5'- CAGACCCACCTGGTATTTGATAAG -3'
Posted On2014-04-24