Incidental Mutation 'R1639:Stim1'
ID173372
Institutional Source Beutler Lab
Gene Symbol Stim1
Ensembl Gene ENSMUSG00000030987
Gene Namestromal interaction molecule 1
SynonymsSIM
MMRRC Submission 039675-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1639 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102267806-102437319 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102354541 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 60 (D60E)
Ref Sequence ENSEMBL: ENSMUSP00000147443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033289] [ENSMUST00000209255] [ENSMUST00000211457]
Predicted Effect probably benign
Transcript: ENSMUST00000033289
AA Change: D60E

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000033289
Gene: ENSMUSG00000030987
AA Change: D60E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
SAM 129 200 5.51e-6 SMART
SCOP:d1eq1a_ 229 334 1e-2 SMART
PDB:4O9B|D 237 340 3e-59 PDB
Pfam:SOAR 341 441 1.4e-46 PFAM
low complexity region 485 499 N/A INTRINSIC
low complexity region 601 631 N/A INTRINSIC
low complexity region 672 685 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209255
AA Change: D60E

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210266
Predicted Effect probably benign
Transcript: ENSMUST00000211457
AA Change: D60E

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal and postnatal lethality, with all mice dying by 2 weeks of age, and severe growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik T C 13: 34,944,250 I150T possibly damaging Het
Acss2 C A 2: 155,556,908 T425N probably benign Het
Adam18 T A 8: 24,652,152 I203L probably benign Het
Amigo2 A G 15: 97,245,998 M181T probably benign Het
Anks1 T A 17: 28,058,306 I1045N probably damaging Het
Ap3d1 C T 10: 80,730,010 V108I probably damaging Het
Arl8a C T 1: 135,152,823 R57* probably null Het
Atp12a A T 14: 56,384,068 D720V possibly damaging Het
Brpf3 T C 17: 28,824,068 probably null Het
C2 T C 17: 34,872,403 K95E probably benign Het
Cdk19 T C 10: 40,476,969 probably null Het
Cebpz T A 17: 78,934,606 I540L possibly damaging Het
Cep128 A G 12: 91,366,368 V41A probably damaging Het
Cog7 T C 7: 121,981,419 E56G probably damaging Het
Cylc2 T C 4: 51,228,310 V127A probably benign Het
Cyp2b23 A G 7: 26,686,417 V5A possibly damaging Het
Cyp8b1 A G 9: 121,914,890 Y459H probably benign Het
Dbpht2 A G 12: 74,299,158 noncoding transcript Het
Ddx24 T C 12: 103,411,319 probably null Het
Dgki C T 6: 36,937,364 C757Y probably damaging Het
Eef2k T A 7: 120,885,828 L306H probably damaging Het
Ephb2 T C 4: 136,693,905 N378S probably benign Het
Espl1 C T 15: 102,320,714 T1767I probably damaging Het
Fbn2 C A 18: 58,058,462 A1530S probably benign Het
Fndc11 A G 2: 181,221,581 S60G possibly damaging Het
Glb1l G T 1: 75,199,601 Q612K probably benign Het
Gpsm1 A G 2: 26,345,187 E371G probably damaging Het
Gtpbp2 G A 17: 46,165,771 probably null Het
Itch A G 2: 155,179,025 probably null Het
Itga2 T C 13: 114,857,296 T774A probably benign Het
Kit A G 5: 75,652,807 I881V probably damaging Het
Lpar5 T C 6: 125,081,601 L95P probably damaging Het
Lrp6 T C 6: 134,453,566 T1511A possibly damaging Het
Mgat4c T C 10: 102,378,281 Y42H probably damaging Het
Mpp3 G T 11: 102,023,442 T109K probably damaging Het
Msantd4 A G 9: 4,385,199 E308G probably damaging Het
Mug1 T C 6: 121,880,571 S1085P probably damaging Het
Myo5b A G 18: 74,707,916 H956R probably benign Het
Ncoa7 A C 10: 30,701,992 L132R probably damaging Het
Ndufc1 T C 3: 51,408,243 T25A probably benign Het
Olfr1254 T C 2: 89,789,245 T36A probably damaging Het
Pkhd1l1 G A 15: 44,540,955 V2327M probably damaging Het
Ppp1r9b T C 11: 94,996,610 Y59H probably damaging Het
Sema4c A T 1: 36,553,534 F152I probably benign Het
Slit2 A T 5: 48,259,654 Y1016F probably damaging Het
Spata31d1c T A 13: 65,036,039 V465D probably benign Het
Ssc5d T C 7: 4,928,417 C208R probably damaging Het
Stambpl1 T G 19: 34,236,307 V312G probably benign Het
Syt13 T A 2: 92,945,971 V201D probably benign Het
Tcaim G A 9: 122,818,773 probably null Het
Tex15 T C 8: 33,570,817 S366P possibly damaging Het
Tpte G A 8: 22,320,897 R190H probably benign Het
Vmn1r4 T C 6: 56,957,075 V188A probably damaging Het
Vmn2r88 A G 14: 51,416,787 D542G probably damaging Het
Vps33b T A 7: 80,284,353 I257N probably damaging Het
Wwox G T 8: 114,445,378 G71* probably null Het
Zc3h11a G T 1: 133,624,708 Q554K probably benign Het
Zfp947 T C 17: 22,146,093 K200R probably benign Het
Zscan12 T A 13: 21,368,986 C327S probably damaging Het
Other mutations in Stim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Stim1 APN 7 102426747 missense probably damaging 1.00
IGL01390:Stim1 APN 7 102427162 missense possibly damaging 0.73
IGL01602:Stim1 APN 7 102386115 missense possibly damaging 0.86
IGL01605:Stim1 APN 7 102386115 missense possibly damaging 0.86
IGL01697:Stim1 APN 7 102425969 splice site probably benign
IGL01826:Stim1 APN 7 102427075 splice site probably benign
IGL01908:Stim1 APN 7 102435650 missense probably benign
IGL02869:Stim1 APN 7 102268551 missense unknown
IGL03146:Stim1 APN 7 102421355 missense probably damaging 1.00
R0217:Stim1 UTSW 7 102435800 missense probably benign 0.00
R1320:Stim1 UTSW 7 102408406 missense possibly damaging 0.79
R1643:Stim1 UTSW 7 102386100 missense possibly damaging 0.92
R1697:Stim1 UTSW 7 102354506 missense probably damaging 1.00
R2424:Stim1 UTSW 7 102408405 missense probably benign 0.03
R3838:Stim1 UTSW 7 102411296 missense possibly damaging 0.71
R3940:Stim1 UTSW 7 102435641 missense probably benign 0.00
R4820:Stim1 UTSW 7 102415364 missense probably damaging 0.97
R4871:Stim1 UTSW 7 102354572 missense probably damaging 1.00
R5110:Stim1 UTSW 7 102268422 missense unknown
R5787:Stim1 UTSW 7 102435440 missense possibly damaging 0.52
R6400:Stim1 UTSW 7 102430950 missense probably null 0.99
R6788:Stim1 UTSW 7 102427291 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGAAGGTTGGATGATGCACTCCC -3'
(R):5'- TTCCTAGAAGGCAACAAGCAGAGGC -3'

Sequencing Primer
(F):5'- TGGATGATGCACTCCCATCAC -3'
(R):5'- ACAAGCAGAGGCCGTCTTTC -3'
Posted On2014-04-24