Incidental Mutation 'R1639:Eef2k'
ID173373
Institutional Source Beutler Lab
Gene Symbol Eef2k
Ensembl Gene ENSMUSG00000035064
Gene Nameeukaryotic elongation factor-2 kinase
SynonymseEF-2K
MMRRC Submission 039675-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.555) question?
Stock #R1639 (G1)
Quality Score162
Status Validated
Chromosome7
Chromosomal Location120842831-120907450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120885828 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 306 (L306H)
Ref Sequence ENSEMBL: ENSMUSP00000102098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047875] [ENSMUST00000106488] [ENSMUST00000106489] [ENSMUST00000146482]
Predicted Effect probably damaging
Transcript: ENSMUST00000047875
AA Change: L306H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046595
Gene: ENSMUSG00000035064
AA Change: L306H

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 525 562 7.2e-5 PFAM
Pfam:Sel1 564 608 2.9e-3 PFAM
Pfam:Sel1 609 645 1.3e-1 PFAM
Pfam:Sel1 665 699 1.2e-2 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106488
AA Change: L306H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102097
Gene: ENSMUSG00000035064
AA Change: L306H

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 522 562 1.1e-3 PFAM
Pfam:Sel1 564 608 3.9e-3 PFAM
Pfam:Sel1 609 645 4.8e-2 PFAM
Pfam:Sel1 664 699 4.6e-3 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106489
AA Change: L306H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102098
Gene: ENSMUSG00000035064
AA Change: L306H

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 522 562 1.1e-3 PFAM
Pfam:Sel1 564 608 3.9e-3 PFAM
Pfam:Sel1 609 645 4.8e-2 PFAM
Pfam:Sel1 664 699 4.6e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207651
Meta Mutation Damage Score 0.27 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved protein kinase in the calmodulin-mediated signaling pathway that links activation of cell surface receptors to cell division. This kinase is involved in the regulation of protein synthesis. It phosphorylates eukaryotic elongation factor 2 (EEF2) and thus inhibits the EEF2 function. The activity of this kinase is increased in many cancers and may be a valid target for anti-cancer treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired regulation of ovarian follicular degeneration and apoptosis, prolonged estrus, and increased ovarian follicle numbers in aged females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik T C 13: 34,944,250 I150T possibly damaging Het
Acss2 C A 2: 155,556,908 T425N probably benign Het
Adam18 T A 8: 24,652,152 I203L probably benign Het
Amigo2 A G 15: 97,245,998 M181T probably benign Het
Anks1 T A 17: 28,058,306 I1045N probably damaging Het
Ap3d1 C T 10: 80,730,010 V108I probably damaging Het
Arl8a C T 1: 135,152,823 R57* probably null Het
Atp12a A T 14: 56,384,068 D720V possibly damaging Het
Brpf3 T C 17: 28,824,068 probably null Het
C2 T C 17: 34,872,403 K95E probably benign Het
Cdk19 T C 10: 40,476,969 probably null Het
Cebpz T A 17: 78,934,606 I540L possibly damaging Het
Cep128 A G 12: 91,366,368 V41A probably damaging Het
Cog7 T C 7: 121,981,419 E56G probably damaging Het
Cylc2 T C 4: 51,228,310 V127A probably benign Het
Cyp2b23 A G 7: 26,686,417 V5A possibly damaging Het
Cyp8b1 A G 9: 121,914,890 Y459H probably benign Het
Dbpht2 A G 12: 74,299,158 noncoding transcript Het
Ddx24 T C 12: 103,411,319 probably null Het
Dgki C T 6: 36,937,364 C757Y probably damaging Het
Ephb2 T C 4: 136,693,905 N378S probably benign Het
Espl1 C T 15: 102,320,714 T1767I probably damaging Het
Fbn2 C A 18: 58,058,462 A1530S probably benign Het
Fndc11 A G 2: 181,221,581 S60G possibly damaging Het
Glb1l G T 1: 75,199,601 Q612K probably benign Het
Gpsm1 A G 2: 26,345,187 E371G probably damaging Het
Gtpbp2 G A 17: 46,165,771 probably null Het
Itch A G 2: 155,179,025 probably null Het
Itga2 T C 13: 114,857,296 T774A probably benign Het
Kit A G 5: 75,652,807 I881V probably damaging Het
Lpar5 T C 6: 125,081,601 L95P probably damaging Het
Lrp6 T C 6: 134,453,566 T1511A possibly damaging Het
Mgat4c T C 10: 102,378,281 Y42H probably damaging Het
Mpp3 G T 11: 102,023,442 T109K probably damaging Het
Msantd4 A G 9: 4,385,199 E308G probably damaging Het
Mug1 T C 6: 121,880,571 S1085P probably damaging Het
Myo5b A G 18: 74,707,916 H956R probably benign Het
Ncoa7 A C 10: 30,701,992 L132R probably damaging Het
Ndufc1 T C 3: 51,408,243 T25A probably benign Het
Olfr1254 T C 2: 89,789,245 T36A probably damaging Het
Pkhd1l1 G A 15: 44,540,955 V2327M probably damaging Het
Ppp1r9b T C 11: 94,996,610 Y59H probably damaging Het
Sema4c A T 1: 36,553,534 F152I probably benign Het
Slit2 A T 5: 48,259,654 Y1016F probably damaging Het
Spata31d1c T A 13: 65,036,039 V465D probably benign Het
Ssc5d T C 7: 4,928,417 C208R probably damaging Het
Stambpl1 T G 19: 34,236,307 V312G probably benign Het
Stim1 T A 7: 102,354,541 D60E probably benign Het
Syt13 T A 2: 92,945,971 V201D probably benign Het
Tcaim G A 9: 122,818,773 probably null Het
Tex15 T C 8: 33,570,817 S366P possibly damaging Het
Tpte G A 8: 22,320,897 R190H probably benign Het
Vmn1r4 T C 6: 56,957,075 V188A probably damaging Het
Vmn2r88 A G 14: 51,416,787 D542G probably damaging Het
Vps33b T A 7: 80,284,353 I257N probably damaging Het
Wwox G T 8: 114,445,378 G71* probably null Het
Zc3h11a G T 1: 133,624,708 Q554K probably benign Het
Zfp947 T C 17: 22,146,093 K200R probably benign Het
Zscan12 T A 13: 21,368,986 C327S probably damaging Het
Other mutations in Eef2k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Eef2k APN 7 120884815 unclassified probably benign
IGL01481:Eef2k APN 7 120895218 missense probably benign 0.23
IGL01935:Eef2k APN 7 120885831 missense probably damaging 1.00
IGL03109:Eef2k APN 7 120891726 missense probably damaging 1.00
R0458:Eef2k UTSW 7 120903290 missense probably damaging 0.99
R1986:Eef2k UTSW 7 120873346 missense possibly damaging 0.92
R3419:Eef2k UTSW 7 120885870 missense probably damaging 0.99
R3610:Eef2k UTSW 7 120889235 missense probably benign
R3707:Eef2k UTSW 7 120884712 missense probably damaging 1.00
R3856:Eef2k UTSW 7 120899371 nonsense probably null
R4024:Eef2k UTSW 7 120858598 missense probably benign 0.01
R4535:Eef2k UTSW 7 120858599 nonsense probably null
R4885:Eef2k UTSW 7 120891932 missense probably benign
R5137:Eef2k UTSW 7 120885422 missense probably damaging 0.99
R5137:Eef2k UTSW 7 120885423 missense probably damaging 1.00
R5501:Eef2k UTSW 7 120889248 missense probably benign 0.00
R5610:Eef2k UTSW 7 120886782 missense probably benign 0.00
R5633:Eef2k UTSW 7 120873290 intron probably benign
Predicted Primers PCR Primer
(F):5'- TTGGCTTGCCTGATCCATGACC -3'
(R):5'- ACACACGCATGTTCCCTGTCAC -3'

Sequencing Primer
(F):5'- GATCCATGACCCCCTTCTG -3'
(R):5'- CCTCACTCTGGTCATAAATAGGC -3'
Posted On2014-04-24