Incidental Mutation 'R1639:Tex15'
ID173377
Institutional Source Beutler Lab
Gene Symbol Tex15
Ensembl Gene ENSMUSG00000009628
Gene Nametestis expressed gene 15
Synonyms2210014E14Rik
MMRRC Submission 039675-MU
Accession Numbers

NCBI RefSeq: NM_031374.2; MGI: 1934816

Is this an essential gene? Possibly essential (E-score: 0.507) question?
Stock #R1639 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location33516738-33585582 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33570817 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 366 (S366P)
Ref Sequence ENSEMBL: ENSMUSP00000120744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009772] [ENSMUST00000124496] [ENSMUST00000124501]
Predicted Effect possibly damaging
Transcript: ENSMUST00000009772
AA Change: S92P

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000009772
Gene: ENSMUSG00000009628
AA Change: S92P

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
low complexity region 302 313 N/A INTRINSIC
low complexity region 524 536 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
low complexity region 713 725 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
low complexity region 1497 1508 N/A INTRINSIC
Pfam:TEX15 1572 1788 1.3e-109 PFAM
Pfam:TEX15 1901 2119 1.1e-16 PFAM
low complexity region 2758 2770 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000124496
AA Change: S366P

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120744
Gene: ENSMUSG00000009628
AA Change: S366P

DomainStartEndE-ValueType
Pfam:DUF3715 89 251 1.6e-58 PFAM
low complexity region 536 548 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 798 810 N/A INTRINSIC
low complexity region 939 948 N/A INTRINSIC
low complexity region 987 999 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124501
SMART Domains Protein: ENSMUSP00000138070
Gene: ENSMUSG00000009628

DomainStartEndE-ValueType
Pfam:DUF3715 96 251 2.4e-52 PFAM
Meta Mutation Damage Score 0.1096 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 96% (66/69)
MGI Phenotype Strain: 3526165
PHENOTYPE: Male mice are infertile due to arrest of meiosis stemming from failure to repair double-strand breaks. However, female mice are fertile. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik T C 13: 34,944,250 I150T possibly damaging Het
Acss2 C A 2: 155,556,908 T425N probably benign Het
Adam18 T A 8: 24,652,152 I203L probably benign Het
Amigo2 A G 15: 97,245,998 M181T probably benign Het
Anks1 T A 17: 28,058,306 I1045N probably damaging Het
Ap3d1 C T 10: 80,730,010 V108I probably damaging Het
Arl8a C T 1: 135,152,823 R57* probably null Het
Atp12a A T 14: 56,384,068 D720V possibly damaging Het
Brpf3 T C 17: 28,824,068 probably null Het
C2 T C 17: 34,872,403 K95E probably benign Het
Cdk19 T C 10: 40,476,969 probably null Het
Cebpz T A 17: 78,934,606 I540L possibly damaging Het
Cep128 A G 12: 91,366,368 V41A probably damaging Het
Cog7 T C 7: 121,981,419 E56G probably damaging Het
Cylc2 T C 4: 51,228,310 V127A probably benign Het
Cyp2b23 A G 7: 26,686,417 V5A possibly damaging Het
Cyp8b1 A G 9: 121,914,890 Y459H probably benign Het
Dbpht2 A G 12: 74,299,158 noncoding transcript Het
Ddx24 T C 12: 103,411,319 probably null Het
Dgki C T 6: 36,937,364 C757Y probably damaging Het
Eef2k T A 7: 120,885,828 L306H probably damaging Het
Ephb2 T C 4: 136,693,905 N378S probably benign Het
Espl1 C T 15: 102,320,714 T1767I probably damaging Het
Fbn2 C A 18: 58,058,462 A1530S probably benign Het
Fndc11 A G 2: 181,221,581 S60G possibly damaging Het
Glb1l G T 1: 75,199,601 Q612K probably benign Het
Gpsm1 A G 2: 26,345,187 E371G probably damaging Het
Gtpbp2 G A 17: 46,165,771 probably null Het
Itch A G 2: 155,179,025 probably null Het
Itga2 T C 13: 114,857,296 T774A probably benign Het
Kit A G 5: 75,652,807 I881V probably damaging Het
Lpar5 T C 6: 125,081,601 L95P probably damaging Het
Lrp6 T C 6: 134,453,566 T1511A possibly damaging Het
Mgat4c T C 10: 102,378,281 Y42H probably damaging Het
Mpp3 G T 11: 102,023,442 T109K probably damaging Het
Msantd4 A G 9: 4,385,199 E308G probably damaging Het
Mug1 T C 6: 121,880,571 S1085P probably damaging Het
Myo5b A G 18: 74,707,916 H956R probably benign Het
Ncoa7 A C 10: 30,701,992 L132R probably damaging Het
Ndufc1 T C 3: 51,408,243 T25A probably benign Het
Olfr1254 T C 2: 89,789,245 T36A probably damaging Het
Pkhd1l1 G A 15: 44,540,955 V2327M probably damaging Het
Ppp1r9b T C 11: 94,996,610 Y59H probably damaging Het
Sema4c A T 1: 36,553,534 F152I probably benign Het
Slit2 A T 5: 48,259,654 Y1016F probably damaging Het
Spata31d1c T A 13: 65,036,039 V465D probably benign Het
Ssc5d T C 7: 4,928,417 C208R probably damaging Het
Stambpl1 T G 19: 34,236,307 V312G probably benign Het
Stim1 T A 7: 102,354,541 D60E probably benign Het
Syt13 T A 2: 92,945,971 V201D probably benign Het
Tcaim G A 9: 122,818,773 probably null Het
Tpte G A 8: 22,320,897 R190H probably benign Het
Vmn1r4 T C 6: 56,957,075 V188A probably damaging Het
Vmn2r88 A G 14: 51,416,787 D542G probably damaging Het
Vps33b T A 7: 80,284,353 I257N probably damaging Het
Wwox G T 8: 114,445,378 G71* probably null Het
Zc3h11a G T 1: 133,624,708 Q554K probably benign Het
Zfp947 T C 17: 22,146,093 K200R probably benign Het
Zscan12 T A 13: 21,368,986 C327S probably damaging Het
Other mutations in Tex15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Tex15 APN 8 33575311 missense probably benign 0.18
IGL00705:Tex15 APN 8 33581592 missense probably damaging 1.00
IGL00820:Tex15 APN 8 33579006 splice site probably benign
IGL01288:Tex15 APN 8 33571384 missense probably benign 0.02
IGL01328:Tex15 APN 8 33571396 nonsense probably null
IGL01359:Tex15 APN 8 33581898 missense probably damaging 0.99
IGL01603:Tex15 APN 8 33573547 missense possibly damaging 0.93
IGL01861:Tex15 APN 8 33570689 missense probably damaging 1.00
IGL02052:Tex15 APN 8 33582465 missense probably benign 0.28
IGL02560:Tex15 APN 8 33581751 missense probably benign 0.00
IGL02677:Tex15 APN 8 33571080 missense probably benign 0.03
IGL02739:Tex15 APN 8 33581693 missense possibly damaging 0.68
Big_gulp UTSW 8 33581734 missense probably damaging 1.00
P0005:Tex15 UTSW 8 33570868 missense probably benign 0.00
P0037:Tex15 UTSW 8 33581580 missense probably benign 0.00
PIT4377001:Tex15 UTSW 8 33571101 missense probably damaging 1.00
R0056:Tex15 UTSW 8 33582027 missense probably benign 0.00
R0056:Tex15 UTSW 8 33582027 missense probably benign 0.00
R0058:Tex15 UTSW 8 33581502 splice site probably benign
R0058:Tex15 UTSW 8 33581502 splice site probably benign
R0595:Tex15 UTSW 8 33572617 missense probably damaging 1.00
R0646:Tex15 UTSW 8 33582326 missense possibly damaging 0.83
R0688:Tex15 UTSW 8 33573500 missense probably damaging 1.00
R0842:Tex15 UTSW 8 33571547 missense possibly damaging 0.95
R0987:Tex15 UTSW 8 33576847 missense probably damaging 1.00
R1084:Tex15 UTSW 8 33577004 missense probably benign 0.28
R1183:Tex15 UTSW 8 33574865 missense probably benign 0.35
R1186:Tex15 UTSW 8 33571633 missense probably benign 0.19
R1378:Tex15 UTSW 8 33575216 missense probably damaging 0.99
R1500:Tex15 UTSW 8 33575092 missense probably damaging 0.96
R1508:Tex15 UTSW 8 33576852 missense probably damaging 1.00
R1597:Tex15 UTSW 8 33571483 missense probably damaging 0.96
R1636:Tex15 UTSW 8 33576387 nonsense probably null
R1809:Tex15 UTSW 8 33574234 missense probably benign
R1843:Tex15 UTSW 8 33576654 missense probably benign 0.27
R2029:Tex15 UTSW 8 33571274 missense probably damaging 0.99
R2228:Tex15 UTSW 8 33571237 missense probably benign 0.05
R2229:Tex15 UTSW 8 33571237 missense probably benign 0.05
R2245:Tex15 UTSW 8 33571496 missense possibly damaging 0.77
R2246:Tex15 UTSW 8 33582512 missense possibly damaging 0.49
R2880:Tex15 UTSW 8 33574907 nonsense probably null
R2881:Tex15 UTSW 8 33574907 nonsense probably null
R2882:Tex15 UTSW 8 33574907 nonsense probably null
R3001:Tex15 UTSW 8 33574528 missense probably benign 0.15
R3002:Tex15 UTSW 8 33574528 missense probably benign 0.15
R3020:Tex15 UTSW 8 33576670 missense probably damaging 1.00
R3084:Tex15 UTSW 8 33574885 missense probably benign 0.11
R3085:Tex15 UTSW 8 33574885 missense probably benign 0.11
R3701:Tex15 UTSW 8 33574166 missense probably benign 0.00
R3702:Tex15 UTSW 8 33574166 missense probably benign 0.00
R3752:Tex15 UTSW 8 33571415 missense probably benign
R4162:Tex15 UTSW 8 33581558 missense probably damaging 1.00
R4231:Tex15 UTSW 8 33572137 missense probably damaging 0.99
R4589:Tex15 UTSW 8 33557373 missense probably damaging 1.00
R4707:Tex15 UTSW 8 33582497 missense probably benign 0.00
R4773:Tex15 UTSW 8 33582732 missense probably benign 0.42
R4967:Tex15 UTSW 8 33574470 missense probably benign 0.34
R5063:Tex15 UTSW 8 33582610 missense possibly damaging 0.59
R5121:Tex15 UTSW 8 33571766 missense probably damaging 1.00
R5147:Tex15 UTSW 8 33572312 nonsense probably null
R5166:Tex15 UTSW 8 33576392 missense probably benign 0.07
R5173:Tex15 UTSW 8 33571740 missense possibly damaging 0.73
R5439:Tex15 UTSW 8 33574171 missense possibly damaging 0.93
R5537:Tex15 UTSW 8 33571613 missense probably damaging 1.00
R5580:Tex15 UTSW 8 33572429 missense probably damaging 1.00
R5588:Tex15 UTSW 8 33577187 missense probably damaging 1.00
R5696:Tex15 UTSW 8 33573192 missense probably benign 0.01
R5734:Tex15 UTSW 8 33546336 missense probably benign 0.01
R5756:Tex15 UTSW 8 33575833 missense probably benign 0.17
R5823:Tex15 UTSW 8 33570934 missense possibly damaging 0.67
R6126:Tex15 UTSW 8 33573563 missense probably benign 0.19
R6129:Tex15 UTSW 8 33574130 missense possibly damaging 0.90
R6276:Tex15 UTSW 8 33577189 missense possibly damaging 0.93
R6374:Tex15 UTSW 8 33575912 missense probably damaging 1.00
R6430:Tex15 UTSW 8 33571301 missense probably benign 0.01
R6452:Tex15 UTSW 8 33572816 missense probably damaging 1.00
R6471:Tex15 UTSW 8 33581734 missense probably damaging 1.00
R6700:Tex15 UTSW 8 33574889 missense possibly damaging 0.93
R6918:Tex15 UTSW 8 33573184 missense probably benign 0.27
R6958:Tex15 UTSW 8 33570871 missense probably benign 0.01
R6970:Tex15 UTSW 8 33557428 missense probably benign 0.03
R7059:Tex15 UTSW 8 33574730 missense possibly damaging 0.57
R7069:Tex15 UTSW 8 33570720 missense probably benign
R7072:Tex15 UTSW 8 33575431 missense possibly damaging 0.85
R7212:Tex15 UTSW 8 33570826 nonsense probably null
R7212:Tex15 UTSW 8 33572995 missense probably damaging 1.00
R7216:Tex15 UTSW 8 33572986 missense possibly damaging 0.93
R7219:Tex15 UTSW 8 33546240 missense probably benign 0.40
R7313:Tex15 UTSW 8 33574817 missense possibly damaging 0.82
R7315:Tex15 UTSW 8 33581516 missense probably benign 0.01
R7444:Tex15 UTSW 8 33576562 missense possibly damaging 0.92
R7455:Tex15 UTSW 8 33576997 missense possibly damaging 0.91
X0020:Tex15 UTSW 8 33576579 missense probably benign 0.03
X0065:Tex15 UTSW 8 33575517 nonsense probably null
Z1088:Tex15 UTSW 8 33571315 missense possibly damaging 0.89
Z1088:Tex15 UTSW 8 33571810 missense possibly damaging 0.68
Z1088:Tex15 UTSW 8 33574870 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAACTGTCAGCTACACTCACCCAT -3'
(R):5'- TCAGCAGGAACTTCCGATGAAGAGA -3'

Sequencing Primer
(F):5'- GATGCTACAGTCATCTTTGAACAC -3'
(R):5'- GAAGTAATAACTGTACTTGAGCCAG -3'
Posted On2014-04-24