Incidental Mutation 'R1639:Wwox'
ID173378
Institutional Source Beutler Lab
Gene Symbol Wwox
Ensembl Gene ENSMUSG00000004637
Gene NameWW domain-containing oxidoreductase
Synonyms9030416C10Rik, WOX1, 5330426P09Rik
MMRRC Submission 039675-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #R1639 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location114439655-115352708 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 114445378 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 71 (G71*)
Ref Sequence ENSEMBL: ENSMUSP00000125626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004756] [ENSMUST00000109107] [ENSMUST00000109108] [ENSMUST00000160862]
Predicted Effect probably null
Transcript: ENSMUST00000004756
AA Change: G71*
SMART Domains Protein: ENSMUSP00000004756
Gene: ENSMUSG00000004637
AA Change: G71*

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Pfam:KR 125 267 3e-9 PFAM
Pfam:adh_short 125 269 2.2e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109107
AA Change: G71*
SMART Domains Protein: ENSMUSP00000104735
Gene: ENSMUSG00000004637
AA Change: G71*

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109108
AA Change: G71*
SMART Domains Protein: ENSMUSP00000104736
Gene: ENSMUSG00000004637
AA Change: G71*

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Pfam:KR 125 267 1.4e-9 PFAM
Pfam:adh_short 125 270 4e-20 PFAM
Pfam:adh_short_C2 131 268 2.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160005
Predicted Effect probably null
Transcript: ENSMUST00000160862
AA Change: G71*
SMART Domains Protein: ENSMUSP00000125626
Gene: ENSMUSG00000004637
AA Change: G71*

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Pfam:KR 125 267 1.3e-9 PFAM
Pfam:adh_short 125 270 3.7e-20 PFAM
Pfam:adh_short_C2 131 268 2.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161753
Meta Mutation Damage Score 0.566 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) protein family. This gene spans the FRA16D common chromosomal fragile site and appears to function as a tumor suppressor gene. Expression of the encoded protein is able to induce apoptosis, while defects in this gene are associated with multiple types of cancer. Disruption of this gene is also associated with autosomal recessive spinocerebellar ataxia 12. Disruption of a similar gene in mouse results in impaired steroidogenesis, additionally suggesting a metabolic function for the protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutation of this gene results in premature death and increased incidence of tumor development. Reduced male fertility and testicular atrophy are also observed in mice with a hypomorphic allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik T C 13: 34,944,250 I150T possibly damaging Het
Acss2 C A 2: 155,556,908 T425N probably benign Het
Adam18 T A 8: 24,652,152 I203L probably benign Het
Amigo2 A G 15: 97,245,998 M181T probably benign Het
Anks1 T A 17: 28,058,306 I1045N probably damaging Het
Ap3d1 C T 10: 80,730,010 V108I probably damaging Het
Arl8a C T 1: 135,152,823 R57* probably null Het
Atp12a A T 14: 56,384,068 D720V possibly damaging Het
Brpf3 T C 17: 28,824,068 probably null Het
C2 T C 17: 34,872,403 K95E probably benign Het
Cdk19 T C 10: 40,476,969 probably null Het
Cebpz T A 17: 78,934,606 I540L possibly damaging Het
Cep128 A G 12: 91,366,368 V41A probably damaging Het
Cog7 T C 7: 121,981,419 E56G probably damaging Het
Cylc2 T C 4: 51,228,310 V127A probably benign Het
Cyp2b23 A G 7: 26,686,417 V5A possibly damaging Het
Cyp8b1 A G 9: 121,914,890 Y459H probably benign Het
Dbpht2 A G 12: 74,299,158 noncoding transcript Het
Ddx24 T C 12: 103,411,319 probably null Het
Dgki C T 6: 36,937,364 C757Y probably damaging Het
Eef2k T A 7: 120,885,828 L306H probably damaging Het
Ephb2 T C 4: 136,693,905 N378S probably benign Het
Espl1 C T 15: 102,320,714 T1767I probably damaging Het
Fbn2 C A 18: 58,058,462 A1530S probably benign Het
Fndc11 A G 2: 181,221,581 S60G possibly damaging Het
Glb1l G T 1: 75,199,601 Q612K probably benign Het
Gpsm1 A G 2: 26,345,187 E371G probably damaging Het
Gtpbp2 G A 17: 46,165,771 probably null Het
Itch A G 2: 155,179,025 probably null Het
Itga2 T C 13: 114,857,296 T774A probably benign Het
Kit A G 5: 75,652,807 I881V probably damaging Het
Lpar5 T C 6: 125,081,601 L95P probably damaging Het
Lrp6 T C 6: 134,453,566 T1511A possibly damaging Het
Mgat4c T C 10: 102,378,281 Y42H probably damaging Het
Mpp3 G T 11: 102,023,442 T109K probably damaging Het
Msantd4 A G 9: 4,385,199 E308G probably damaging Het
Mug1 T C 6: 121,880,571 S1085P probably damaging Het
Myo5b A G 18: 74,707,916 H956R probably benign Het
Ncoa7 A C 10: 30,701,992 L132R probably damaging Het
Ndufc1 T C 3: 51,408,243 T25A probably benign Het
Olfr1254 T C 2: 89,789,245 T36A probably damaging Het
Pkhd1l1 G A 15: 44,540,955 V2327M probably damaging Het
Ppp1r9b T C 11: 94,996,610 Y59H probably damaging Het
Sema4c A T 1: 36,553,534 F152I probably benign Het
Slit2 A T 5: 48,259,654 Y1016F probably damaging Het
Spata31d1c T A 13: 65,036,039 V465D probably benign Het
Ssc5d T C 7: 4,928,417 C208R probably damaging Het
Stambpl1 T G 19: 34,236,307 V312G probably benign Het
Stim1 T A 7: 102,354,541 D60E probably benign Het
Syt13 T A 2: 92,945,971 V201D probably benign Het
Tcaim G A 9: 122,818,773 probably null Het
Tex15 T C 8: 33,570,817 S366P possibly damaging Het
Tpte G A 8: 22,320,897 R190H probably benign Het
Vmn1r4 T C 6: 56,957,075 V188A probably damaging Het
Vmn2r88 A G 14: 51,416,787 D542G probably damaging Het
Vps33b T A 7: 80,284,353 I257N probably damaging Het
Zc3h11a G T 1: 133,624,708 Q554K probably benign Het
Zfp947 T C 17: 22,146,093 K200R probably benign Het
Zscan12 T A 13: 21,368,986 C327S probably damaging Het
Other mutations in Wwox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Wwox APN 8 114445378 nonsense probably null
IGL02156:Wwox APN 8 114448159 critical splice acceptor site probably null
IGL02267:Wwox APN 8 114712065 missense probably benign 0.23
IGL02346:Wwox APN 8 114712118 missense probably benign 0.11
IGL02350:Wwox APN 8 114712142 missense possibly damaging 0.81
IGL02357:Wwox APN 8 114712142 missense possibly damaging 0.81
IGL02586:Wwox APN 8 114712207 missense possibly damaging 0.59
IGL02701:Wwox APN 8 114706368 missense probably damaging 1.00
IGL02743:Wwox APN 8 115351704 missense probably damaging 1.00
IGL02804:Wwox APN 8 114712013 missense probably damaging 1.00
IGL02805:Wwox APN 8 114712013 missense probably damaging 1.00
R0048:Wwox UTSW 8 114439830 missense probably damaging 1.00
R0140:Wwox UTSW 8 114706287 missense probably damaging 1.00
R0390:Wwox UTSW 8 114706278 missense probably benign 0.08
R1146:Wwox UTSW 8 114712036 missense possibly damaging 0.95
R1146:Wwox UTSW 8 114712036 missense possibly damaging 0.95
R1193:Wwox UTSW 8 114679874 missense probably benign
R1520:Wwox UTSW 8 114712133 missense probably benign 0.36
R1552:Wwox UTSW 8 114445350 nonsense probably null
R1628:Wwox UTSW 8 114448233 missense probably benign
R3778:Wwox UTSW 8 114874607 missense probably benign 0.00
R3967:Wwox UTSW 8 114488933 missense probably damaging 1.00
R4077:Wwox UTSW 8 114439741 utr 5 prime probably benign
R4876:Wwox UTSW 8 114448248 missense probably damaging 1.00
R4936:Wwox UTSW 8 114706358 missense probably benign 0.00
R5868:Wwox UTSW 8 114679846 missense probably benign
R5988:Wwox UTSW 8 114706341 missense probably benign 0.06
R6272:Wwox UTSW 8 114488952 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTAACTGCCATGTGACCAGCC -3'
(R):5'- CTCAGGACGAGCCGCTTAAAGAAG -3'

Sequencing Primer
(F):5'- ACCAGCCTGGTCCAGGAG -3'
(R):5'- aaaagaaggaaagaaagaaaagaagC -3'
Posted On2014-04-24