Incidental Mutation 'R1639:Cyp8b1'
ID173381
Institutional Source Beutler Lab
Gene Symbol Cyp8b1
Ensembl Gene ENSMUSG00000050445
Gene Namecytochrome P450, family 8, subfamily b, polypeptide 1
Synonymssterol 12-alpha-hydrolase
MMRRC Submission 039675-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R1639 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location121914356-121916305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121914890 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 459 (Y459H)
Ref Sequence ENSEMBL: ENSMUSP00000052989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050327] [ENSMUST00000062474] [ENSMUST00000214340]
Predicted Effect probably benign
Transcript: ENSMUST00000050327
SMART Domains Protein: ENSMUSP00000050119
Gene: ENSMUSG00000044534

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
Pfam:7tm_1 62 311 1e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000062474
AA Change: Y459H

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000052989
Gene: ENSMUSG00000050445
AA Change: Y459H

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Pfam:p450 32 492 5.7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214340
Meta Mutation Damage Score 0.1244 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum membrane protein catalyzes the conversion of 7 alpha-hydroxy-4-cholesten-3-one into 7-alpha,12-alpha-dihydroxy-4-cholesten-3-one. The balance between these two steroids determines the relative amounts of cholic acid and chenodeoxycholic acid both of which are secreted in the bile and affect the solubility of cholesterol. This gene is unique among the cytochrome P450 genes in that it is intronless. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele lack synthsesis of cholate (a primary bile acid) and its metabolites and display an increased bile acid pool and alterations in cholesterol metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik T C 13: 34,944,250 I150T possibly damaging Het
Acss2 C A 2: 155,556,908 T425N probably benign Het
Adam18 T A 8: 24,652,152 I203L probably benign Het
Amigo2 A G 15: 97,245,998 M181T probably benign Het
Anks1 T A 17: 28,058,306 I1045N probably damaging Het
Ap3d1 C T 10: 80,730,010 V108I probably damaging Het
Arl8a C T 1: 135,152,823 R57* probably null Het
Atp12a A T 14: 56,384,068 D720V possibly damaging Het
Brpf3 T C 17: 28,824,068 probably null Het
C2 T C 17: 34,872,403 K95E probably benign Het
Cdk19 T C 10: 40,476,969 probably null Het
Cebpz T A 17: 78,934,606 I540L possibly damaging Het
Cep128 A G 12: 91,366,368 V41A probably damaging Het
Cog7 T C 7: 121,981,419 E56G probably damaging Het
Cylc2 T C 4: 51,228,310 V127A probably benign Het
Cyp2b23 A G 7: 26,686,417 V5A possibly damaging Het
Dbpht2 A G 12: 74,299,158 noncoding transcript Het
Ddx24 T C 12: 103,411,319 probably null Het
Dgki C T 6: 36,937,364 C757Y probably damaging Het
Eef2k T A 7: 120,885,828 L306H probably damaging Het
Ephb2 T C 4: 136,693,905 N378S probably benign Het
Espl1 C T 15: 102,320,714 T1767I probably damaging Het
Fbn2 C A 18: 58,058,462 A1530S probably benign Het
Fndc11 A G 2: 181,221,581 S60G possibly damaging Het
Glb1l G T 1: 75,199,601 Q612K probably benign Het
Gpsm1 A G 2: 26,345,187 E371G probably damaging Het
Gtpbp2 G A 17: 46,165,771 probably null Het
Itch A G 2: 155,179,025 probably null Het
Itga2 T C 13: 114,857,296 T774A probably benign Het
Kit A G 5: 75,652,807 I881V probably damaging Het
Lpar5 T C 6: 125,081,601 L95P probably damaging Het
Lrp6 T C 6: 134,453,566 T1511A possibly damaging Het
Mgat4c T C 10: 102,378,281 Y42H probably damaging Het
Mpp3 G T 11: 102,023,442 T109K probably damaging Het
Msantd4 A G 9: 4,385,199 E308G probably damaging Het
Mug1 T C 6: 121,880,571 S1085P probably damaging Het
Myo5b A G 18: 74,707,916 H956R probably benign Het
Ncoa7 A C 10: 30,701,992 L132R probably damaging Het
Ndufc1 T C 3: 51,408,243 T25A probably benign Het
Olfr1254 T C 2: 89,789,245 T36A probably damaging Het
Pkhd1l1 G A 15: 44,540,955 V2327M probably damaging Het
Ppp1r9b T C 11: 94,996,610 Y59H probably damaging Het
Sema4c A T 1: 36,553,534 F152I probably benign Het
Slit2 A T 5: 48,259,654 Y1016F probably damaging Het
Spata31d1c T A 13: 65,036,039 V465D probably benign Het
Ssc5d T C 7: 4,928,417 C208R probably damaging Het
Stambpl1 T G 19: 34,236,307 V312G probably benign Het
Stim1 T A 7: 102,354,541 D60E probably benign Het
Syt13 T A 2: 92,945,971 V201D probably benign Het
Tcaim G A 9: 122,818,773 probably null Het
Tex15 T C 8: 33,570,817 S366P possibly damaging Het
Tpte G A 8: 22,320,897 R190H probably benign Het
Vmn1r4 T C 6: 56,957,075 V188A probably damaging Het
Vmn2r88 A G 14: 51,416,787 D542G probably damaging Het
Vps33b T A 7: 80,284,353 I257N probably damaging Het
Wwox G T 8: 114,445,378 G71* probably null Het
Zc3h11a G T 1: 133,624,708 Q554K probably benign Het
Zfp947 T C 17: 22,146,093 K200R probably benign Het
Zscan12 T A 13: 21,368,986 C327S probably damaging Het
Other mutations in Cyp8b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Cyp8b1 APN 9 121914995 missense probably damaging 0.98
IGL01874:Cyp8b1 APN 9 121915903 missense possibly damaging 0.71
IGL02004:Cyp8b1 APN 9 121914992 missense probably benign 0.01
IGL02218:Cyp8b1 APN 9 121915117 missense probably damaging 1.00
IGL02606:Cyp8b1 APN 9 121915735 missense probably damaging 1.00
IGL02724:Cyp8b1 APN 9 121915387 missense probably benign 0.12
IGL02796:Cyp8b1 UTSW 9 121915498 missense probably benign
R1052:Cyp8b1 UTSW 9 121915282 missense possibly damaging 0.67
R1223:Cyp8b1 UTSW 9 121915004 missense possibly damaging 0.71
R1572:Cyp8b1 UTSW 9 121914958 missense possibly damaging 0.94
R3833:Cyp8b1 UTSW 9 121916043 missense probably benign 0.00
R3938:Cyp8b1 UTSW 9 121915618 missense probably benign 0.05
R4151:Cyp8b1 UTSW 9 121916068 missense probably damaging 1.00
R4615:Cyp8b1 UTSW 9 121916098 nonsense probably null
R4625:Cyp8b1 UTSW 9 121915585 missense probably damaging 0.99
R5327:Cyp8b1 UTSW 9 121914884 missense probably damaging 0.99
R6391:Cyp8b1 UTSW 9 121915798 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTCAAGTGTGGGTGAGCCATCAG -3'
(R):5'- TACCAGATCCGTCGCGGAGATAAG -3'

Sequencing Primer
(F):5'- CAGTTGTAAACTGAGCTGACC -3'
(R):5'- GAGATAAGGTGGCTCTCTTCCC -3'
Posted On2014-04-24