Incidental Mutation 'R1639:Cep128'
ID173392
Institutional Source Beutler Lab
Gene Symbol Cep128
Ensembl Gene ENSMUSG00000061533
Gene Namecentrosomal protein 128
Synonyms4930534B04Rik, 5430424K18Rik
MMRRC Submission 039675-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R1639 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location90998492-91384409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91366368 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 41 (V41A)
Ref Sequence ENSEMBL: ENSMUSP00000115679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000141429]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138935
Predicted Effect probably damaging
Transcript: ENSMUST00000141429
AA Change: V41A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115679
Gene: ENSMUSG00000061533
AA Change: V41A

DomainStartEndE-ValueType
low complexity region 89 110 N/A INTRINSIC
coiled coil region 216 329 N/A INTRINSIC
low complexity region 340 352 N/A INTRINSIC
coiled coil region 377 822 N/A INTRINSIC
coiled coil region 876 960 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 96% (66/69)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik T C 13: 34,944,250 I150T possibly damaging Het
Acss2 C A 2: 155,556,908 T425N probably benign Het
Adam18 T A 8: 24,652,152 I203L probably benign Het
Amigo2 A G 15: 97,245,998 M181T probably benign Het
Anks1 T A 17: 28,058,306 I1045N probably damaging Het
Ap3d1 C T 10: 80,730,010 V108I probably damaging Het
Arl8a C T 1: 135,152,823 R57* probably null Het
Atp12a A T 14: 56,384,068 D720V possibly damaging Het
Brpf3 T C 17: 28,824,068 probably null Het
C2 T C 17: 34,872,403 K95E probably benign Het
Cdk19 T C 10: 40,476,969 probably null Het
Cebpz T A 17: 78,934,606 I540L possibly damaging Het
Cog7 T C 7: 121,981,419 E56G probably damaging Het
Cylc2 T C 4: 51,228,310 V127A probably benign Het
Cyp2b23 A G 7: 26,686,417 V5A possibly damaging Het
Cyp8b1 A G 9: 121,914,890 Y459H probably benign Het
Dbpht2 A G 12: 74,299,158 noncoding transcript Het
Ddx24 T C 12: 103,411,319 probably null Het
Dgki C T 6: 36,937,364 C757Y probably damaging Het
Eef2k T A 7: 120,885,828 L306H probably damaging Het
Ephb2 T C 4: 136,693,905 N378S probably benign Het
Espl1 C T 15: 102,320,714 T1767I probably damaging Het
Fbn2 C A 18: 58,058,462 A1530S probably benign Het
Fndc11 A G 2: 181,221,581 S60G possibly damaging Het
Glb1l G T 1: 75,199,601 Q612K probably benign Het
Gpsm1 A G 2: 26,345,187 E371G probably damaging Het
Gtpbp2 G A 17: 46,165,771 probably null Het
Itch A G 2: 155,179,025 probably null Het
Itga2 T C 13: 114,857,296 T774A probably benign Het
Kit A G 5: 75,652,807 I881V probably damaging Het
Lpar5 T C 6: 125,081,601 L95P probably damaging Het
Lrp6 T C 6: 134,453,566 T1511A possibly damaging Het
Mgat4c T C 10: 102,378,281 Y42H probably damaging Het
Mpp3 G T 11: 102,023,442 T109K probably damaging Het
Msantd4 A G 9: 4,385,199 E308G probably damaging Het
Mug1 T C 6: 121,880,571 S1085P probably damaging Het
Myo5b A G 18: 74,707,916 H956R probably benign Het
Ncoa7 A C 10: 30,701,992 L132R probably damaging Het
Ndufc1 T C 3: 51,408,243 T25A probably benign Het
Olfr1254 T C 2: 89,789,245 T36A probably damaging Het
Pkhd1l1 G A 15: 44,540,955 V2327M probably damaging Het
Ppp1r9b T C 11: 94,996,610 Y59H probably damaging Het
Sema4c A T 1: 36,553,534 F152I probably benign Het
Slit2 A T 5: 48,259,654 Y1016F probably damaging Het
Spata31d1c T A 13: 65,036,039 V465D probably benign Het
Ssc5d T C 7: 4,928,417 C208R probably damaging Het
Stambpl1 T G 19: 34,236,307 V312G probably benign Het
Stim1 T A 7: 102,354,541 D60E probably benign Het
Syt13 T A 2: 92,945,971 V201D probably benign Het
Tcaim G A 9: 122,818,773 probably null Het
Tex15 T C 8: 33,570,817 S366P possibly damaging Het
Tpte G A 8: 22,320,897 R190H probably benign Het
Vmn1r4 T C 6: 56,957,075 V188A probably damaging Het
Vmn2r88 A G 14: 51,416,787 D542G probably damaging Het
Vps33b T A 7: 80,284,353 I257N probably damaging Het
Wwox G T 8: 114,445,378 G71* probably null Het
Zc3h11a G T 1: 133,624,708 Q554K probably benign Het
Zfp947 T C 17: 22,146,093 K200R probably benign Het
Zscan12 T A 13: 21,368,986 C327S probably damaging Het
Other mutations in Cep128
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Cep128 APN 12 91234191 missense probably benign 0.17
IGL00800:Cep128 APN 12 91255664 missense possibly damaging 0.83
IGL01738:Cep128 APN 12 91230842 missense probably damaging 1.00
IGL01844:Cep128 APN 12 91008854 missense probably benign 0.14
IGL01918:Cep128 APN 12 91234210 missense probably damaging 0.99
IGL02043:Cep128 APN 12 91266730 splice site probably benign
IGL02405:Cep128 APN 12 91266986 missense probably benign 0.04
IGL02616:Cep128 APN 12 91296258 missense probably benign 0.03
R0416:Cep128 UTSW 12 91230867 splice site probably benign
R0442:Cep128 UTSW 12 91266771 missense probably damaging 1.00
R0608:Cep128 UTSW 12 90999535 utr 3 prime probably benign
R1108:Cep128 UTSW 12 91339109 missense probably damaging 1.00
R1178:Cep128 UTSW 12 91260155 missense probably damaging 1.00
R1183:Cep128 UTSW 12 91325598 missense possibly damaging 0.84
R1394:Cep128 UTSW 12 91266980 missense probably benign 0.07
R1395:Cep128 UTSW 12 91266980 missense probably benign 0.07
R1498:Cep128 UTSW 12 91366417 missense probably benign
R1541:Cep128 UTSW 12 91348781 missense probably damaging 1.00
R1643:Cep128 UTSW 12 91325532 missense probably damaging 1.00
R1682:Cep128 UTSW 12 91230822 missense probably damaging 0.99
R1739:Cep128 UTSW 12 91022491 splice site probably null
R1758:Cep128 UTSW 12 91347578 missense probably benign 0.02
R1845:Cep128 UTSW 12 91289598 missense probably benign 0.01
R1987:Cep128 UTSW 12 91230829 missense probably benign 0.01
R2017:Cep128 UTSW 12 91366464 missense probably damaging 0.98
R2237:Cep128 UTSW 12 91347567 missense probably benign 0.01
R2239:Cep128 UTSW 12 91347567 missense probably benign 0.01
R3103:Cep128 UTSW 12 91019344 missense probably damaging 0.99
R4552:Cep128 UTSW 12 91294162 missense probably damaging 0.98
R4664:Cep128 UTSW 12 91296253 missense probably damaging 1.00
R4774:Cep128 UTSW 12 91234195 missense probably damaging 0.99
R4838:Cep128 UTSW 12 90999545 utr 3 prime probably benign
R4858:Cep128 UTSW 12 91260162 missense probably benign 0.04
R4924:Cep128 UTSW 12 91022400 splice site silent
R5002:Cep128 UTSW 12 91255723 intron probably null
R5282:Cep128 UTSW 12 91339119 missense probably damaging 1.00
R5386:Cep128 UTSW 12 90999571 missense probably benign 0.03
R5476:Cep128 UTSW 12 91213618 missense probably damaging 0.96
R5643:Cep128 UTSW 12 91348851 missense probably damaging 1.00
R5644:Cep128 UTSW 12 91348851 missense probably damaging 1.00
R5668:Cep128 UTSW 12 90999636 missense probably benign 0.01
R6057:Cep128 UTSW 12 91296224 missense possibly damaging 0.92
R6831:Cep128 UTSW 12 91266974 missense probably damaging 0.99
R6852:Cep128 UTSW 12 91366342 critical splice donor site probably null
R7078:Cep128 UTSW 12 91234104 missense not run
R7144:Cep128 UTSW 12 91294159 missense not run
Predicted Primers PCR Primer
(F):5'- CAAGGCAAGGTACATGAGCAGCTAC -3'
(R):5'- ATGCTGGAAGTCAACACTAAGTAACCC -3'

Sequencing Primer
(F):5'- cttctgacctatggagctgtg -3'
(R):5'- CTCCCAAAGTGTAGGTCTTCAGAG -3'
Posted On2014-04-24