Incidental Mutation 'R1640:Dock7'
ID173442
Institutional Source Beutler Lab
Gene Symbol Dock7
Ensembl Gene ENSMUSG00000028556
Gene Namededicator of cytokinesis 7
Synonyms3110056M06Rik, m, LOC242555
MMRRC Submission 039676-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1640 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location98936671-99120915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 98945246 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 1906 (T1906N)
Ref Sequence ENSEMBL: ENSMUSP00000145604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030286] [ENSMUST00000075836] [ENSMUST00000127417] [ENSMUST00000205650] [ENSMUST00000205652]
Predicted Effect probably damaging
Transcript: ENSMUST00000030286
AA Change: T1936N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556
AA Change: T1936N

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000075836
AA Change: T1908N
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556
AA Change: T1908N

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124040
Predicted Effect probably benign
Transcript: ENSMUST00000124466
Predicted Effect unknown
Transcript: ENSMUST00000127417
AA Change: T1938N
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556
AA Change: T1938N

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205484
Predicted Effect probably damaging
Transcript: ENSMUST00000205650
AA Change: T1906N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000205652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206128
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) that plays a role in axon formation and neuronal polarization. The encoded protein displays GEF activity toward RAC1 and RAC3 Rho small GTPases but not toward CDC42. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit coat color dilution, white tail tip, and on some genetic backgrounds a white belly spot. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik C A 8: 124,839,845 V279L probably damaging Het
4931417E11Rik A G 6: 73,468,886 Y227H probably benign Het
Acot6 A T 12: 84,101,126 Y52F probably damaging Het
Adam22 C T 5: 8,145,689 V284I probably damaging Het
Agl A T 3: 116,752,090 H1352Q probably benign Het
Aldh18a1 G A 19: 40,585,499 P27S probably benign Het
C1ra A G 6: 124,522,274 N473S probably benign Het
C87436 T C 6: 86,446,251 L269P probably damaging Het
Calcrl A G 2: 84,333,677 V390A probably damaging Het
Ccp110 T G 7: 118,715,528 probably null Het
Cerk A G 15: 86,149,400 V274A probably damaging Het
Chd1l A T 3: 97,580,991 S570T probably benign Het
Chst14 T A 2: 118,926,898 W83R probably damaging Het
Chsy1 A T 7: 66,171,514 D499V probably benign Het
Ckmt1 C A 2: 121,359,717 probably null Het
Cnot1 A T 8: 95,769,832 V282D probably damaging Het
Cntn3 A T 6: 102,242,013 S549T possibly damaging Het
Cntnap5c A T 17: 58,395,294 D1203V probably benign Het
Col4a4 A G 1: 82,535,770 Y169H unknown Het
Cwc22 A G 2: 77,915,530 F454S possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dhrs7 A T 12: 72,652,315 W298R possibly damaging Het
Dpy19l3 T C 7: 35,749,778 T67A probably benign Het
Drc1 A G 5: 30,363,957 D654G possibly damaging Het
Ech1 A T 7: 28,831,839 H284L probably damaging Het
Epc1 G A 18: 6,441,175 Q8* probably null Het
Etv5 A T 16: 22,435,914 D65E probably damaging Het
F2rl3 A G 8: 72,762,906 R254G probably benign Het
Fabp5 T G 3: 10,015,110 F73L probably benign Het
Fbrs T C 7: 127,487,311 I611T probably damaging Het
Flnc T C 6: 29,433,807 S117P possibly damaging Het
Frmd4b A C 6: 97,308,673 S291A possibly damaging Het
Galnt13 A G 2: 55,060,546 Y413C probably damaging Het
Gfer A G 17: 24,695,363 Y109H possibly damaging Het
Gli2 T C 1: 118,836,524 H1299R possibly damaging Het
Gm10110 T C 14: 89,898,243 noncoding transcript Het
Gprc5a T G 6: 135,078,654 L33W probably damaging Het
Grin3a T C 4: 49,844,721 T121A probably benign Het
Grk3 A G 5: 113,015,382 V33A probably benign Het
Hc A T 2: 35,057,324 Y59* probably null Het
Hrnr A G 3: 93,332,516 I3354V unknown Het
Hyou1 C G 9: 44,389,406 T924S probably benign Het
Ifi209 T G 1: 173,637,365 H20Q probably damaging Het
Ifi44 A G 3: 151,732,534 V372A probably benign Het
Igdcc4 T A 9: 65,122,795 L328H probably damaging Het
Kif18a A G 2: 109,289,816 T155A probably benign Het
Kmt2d A G 15: 98,845,057 probably benign Het
Kri1 T C 9: 21,280,457 D281G possibly damaging Het
Larp1b T A 3: 41,034,072 M1K probably null Het
Loxhd1 A G 18: 77,402,563 D1225G probably damaging Het
Mzf1 A G 7: 13,043,270 *736Q probably null Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Ncf2 T A 1: 152,808,033 M1K probably null Het
Olfr1095 T A 2: 86,851,227 H157L probably benign Het
Olfr1100 A C 2: 86,978,619 M59R probably damaging Het
Parp12 T C 6: 39,096,640 D417G probably benign Het
Parp12 T C 6: 39,111,678 H208R probably damaging Het
Pcif1 T C 2: 164,885,683 I132T probably benign Het
Pck2 A G 14: 55,548,584 D610G possibly damaging Het
Plbd1 T C 6: 136,640,125 K185E probably benign Het
Ppp2r5a T C 1: 191,353,929 M425V probably damaging Het
Rapgef6 T A 11: 54,657,405 V805D probably damaging Het
Rprd2 C T 3: 95,763,747 probably benign Het
Ryr3 A G 2: 112,900,833 S711P probably damaging Het
Slc17a3 T A 13: 23,852,357 L212* probably null Het
Slc4a8 A G 15: 100,783,787 D41G probably benign Het
Slc9a3 T A 13: 74,158,818 V354E probably damaging Het
Spen A G 4: 141,468,943 I3632T probably damaging Het
Tesc A G 5: 118,054,849 S77G probably benign Het
Tet3 A T 6: 83,369,315 V1245D probably benign Het
Tox4 T A 14: 52,292,543 D553E possibly damaging Het
Tpmt A T 13: 47,027,283 Y193* probably null Het
Trio T C 15: 27,833,044 Y1169C probably damaging Het
Urb1 G A 16: 90,772,626 T1404I probably benign Het
Usp47 T C 7: 112,083,127 S540P probably damaging Het
Vmn1r178 A T 7: 23,894,123 M126L possibly damaging Het
Vmn1r223 T C 13: 23,250,178 F314S probably damaging Het
Vmn2r112 A T 17: 22,605,116 I451L probably benign Het
Zfc3h1 A G 10: 115,406,901 probably null Het
Zfp503 A T 14: 21,984,901 L649Q probably damaging Het
Zfp977 A C 7: 42,580,106 C332G probably damaging Het
Other mutations in Dock7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dock7 APN 4 99063985 missense probably damaging 1.00
IGL01126:Dock7 APN 4 98973552 splice site probably benign
IGL01490:Dock7 APN 4 98945118 unclassified probably benign
IGL01553:Dock7 APN 4 98945566 nonsense probably null
IGL01728:Dock7 APN 4 98962331 missense probably damaging 1.00
IGL01776:Dock7 APN 4 98940941 missense possibly damaging 0.65
IGL01954:Dock7 APN 4 99083151 missense probably damaging 0.99
IGL01985:Dock7 APN 4 99023377 missense probably benign 0.35
IGL02054:Dock7 APN 4 98973409 missense probably damaging 1.00
IGL02150:Dock7 APN 4 99079852 splice site probably benign
IGL02153:Dock7 APN 4 98958067 missense probably benign 0.15
IGL02183:Dock7 APN 4 98958991 missense possibly damaging 0.89
IGL02494:Dock7 APN 4 98989234 missense probably benign 0.18
IGL02618:Dock7 APN 4 99083028 missense probably benign 0.00
IGL02634:Dock7 APN 4 98989296 missense probably damaging 1.00
IGL02670:Dock7 APN 4 98966286 splice site probably null
IGL02690:Dock7 APN 4 98969635 missense possibly damaging 0.95
IGL02692:Dock7 APN 4 98987386 missense probably damaging 1.00
IGL02833:Dock7 APN 4 98945495 missense probably damaging 1.00
IGL02858:Dock7 APN 4 98945205 nonsense probably null
IGL02875:Dock7 APN 4 98975994 missense probably benign 0.00
IGL03027:Dock7 APN 4 98977927 missense probably benign
IGL03027:Dock7 APN 4 99070213 missense possibly damaging 0.71
IGL03032:Dock7 APN 4 98966348 missense probably benign 0.02
IGL03104:Dock7 APN 4 98959023 missense possibly damaging 0.60
IGL03136:Dock7 APN 4 99003791 missense probably damaging 1.00
IGL03345:Dock7 APN 4 98984819 missense possibly damaging 0.91
moonlight UTSW 4 large deletion
R0086:Dock7 UTSW 4 98945144 missense probably damaging 1.00
R0242:Dock7 UTSW 4 98962280 missense probably benign
R0242:Dock7 UTSW 4 98962280 missense probably benign
R0245:Dock7 UTSW 4 99055349 missense possibly damaging 0.64
R0308:Dock7 UTSW 4 98984814 missense probably benign 0.07
R0556:Dock7 UTSW 4 98945189 missense probably damaging 1.00
R0612:Dock7 UTSW 4 98989233 missense probably benign 0.31
R0652:Dock7 UTSW 4 99055349 missense possibly damaging 0.64
R0669:Dock7 UTSW 4 98987479 missense probably benign 0.00
R0681:Dock7 UTSW 4 99016704 missense probably damaging 1.00
R0725:Dock7 UTSW 4 98945291 missense probably damaging 1.00
R0828:Dock7 UTSW 4 99015745 missense probably damaging 1.00
R0837:Dock7 UTSW 4 98989258 missense probably benign 0.01
R0962:Dock7 UTSW 4 98945195 missense possibly damaging 0.85
R1140:Dock7 UTSW 4 99065406 missense possibly damaging 0.82
R1476:Dock7 UTSW 4 99079435 missense possibly damaging 0.52
R1614:Dock7 UTSW 4 99061280 missense probably benign 0.12
R1625:Dock7 UTSW 4 98962196 splice site probably null
R1752:Dock7 UTSW 4 98966444 missense probably damaging 1.00
R1941:Dock7 UTSW 4 98984715 missense probably benign 0.09
R2020:Dock7 UTSW 4 98959101 missense probably damaging 1.00
R2092:Dock7 UTSW 4 99009308 missense possibly damaging 0.95
R2293:Dock7 UTSW 4 98966369 missense probably damaging 1.00
R2424:Dock7 UTSW 4 98945307 nonsense probably null
R3767:Dock7 UTSW 4 98970829 missense probably benign
R3768:Dock7 UTSW 4 98970829 missense probably benign
R3769:Dock7 UTSW 4 98970829 missense probably benign
R3770:Dock7 UTSW 4 98970829 missense probably benign
R3917:Dock7 UTSW 4 99016685 missense probably damaging 1.00
R3943:Dock7 UTSW 4 98992431 missense probably damaging 1.00
R4021:Dock7 UTSW 4 99003920 splice site probably null
R4073:Dock7 UTSW 4 99008059 missense probably benign 0.02
R4170:Dock7 UTSW 4 98966401 missense probably damaging 0.99
R4180:Dock7 UTSW 4 99016736 missense probably benign 0.05
R4261:Dock7 UTSW 4 99003886 missense possibly damaging 0.78
R4321:Dock7 UTSW 4 99072454 missense probably damaging 1.00
R4522:Dock7 UTSW 4 98962224 missense probably damaging 1.00
R4582:Dock7 UTSW 4 99003916 missense possibly damaging 0.90
R4648:Dock7 UTSW 4 98969644 nonsense probably null
R4940:Dock7 UTSW 4 99020077 missense probably damaging 1.00
R5090:Dock7 UTSW 4 98991411 missense probably benign 0.04
R5374:Dock7 UTSW 4 98989038 missense possibly damaging 0.81
R5392:Dock7 UTSW 4 99008006 missense probably damaging 1.00
R5527:Dock7 UTSW 4 98953868 intron probably benign
R5544:Dock7 UTSW 4 98967257 missense probably damaging 1.00
R5556:Dock7 UTSW 4 98944735 missense probably damaging 1.00
R5870:Dock7 UTSW 4 99063962 missense probably benign 0.00
R5899:Dock7 UTSW 4 98991423 missense probably benign
R6360:Dock7 UTSW 4 98969662 missense probably benign 0.02
R6415:Dock7 UTSW 4 98992448 missense probably damaging 1.00
R6468:Dock7 UTSW 4 98967227 missense probably benign 0.15
R6562:Dock7 UTSW 4 98991410 missense probably damaging 0.97
R6613:Dock7 UTSW 4 98977960 missense probably damaging 0.99
R6703:Dock7 UTSW 4 98946672 missense probably damaging 1.00
R6723:Dock7 UTSW 4 99003916 missense possibly damaging 0.90
R6786:Dock7 UTSW 4 99061292 missense probably benign 0.42
X0027:Dock7 UTSW 4 99003853 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGTTGCAAATGCCAATTCCTGAG -3'
(R):5'- AGACAGGCACGTTGTTTTGTTTGAC -3'

Sequencing Primer
(F):5'- CACGTAAGTTCACAGTGTGAC -3'
(R):5'- CACATCCTGGGTGACAGATTACTG -3'
Posted On2014-04-24