Incidental Mutation 'R1640:Adam22'
ID173445
Institutional Source Beutler Lab
Gene Symbol Adam22
Ensembl Gene ENSMUSG00000040537
Gene Namea disintegrin and metallopeptidase domain 22
Synonyms2900022I03Rik, MDC2
MMRRC Submission 039676-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1640 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location8072352-8368160 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 8145689 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 284 (V284I)
Ref Sequence ENSEMBL: ENSMUSP00000111043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046838] [ENSMUST00000050166] [ENSMUST00000088744] [ENSMUST00000088761] [ENSMUST00000115385] [ENSMUST00000115386] [ENSMUST00000115388]
Predicted Effect probably damaging
Transcript: ENSMUST00000046838
AA Change: V284I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049120
Gene: ENSMUSG00000040537
AA Change: V284I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 7e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 9.3e-9 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 789 808 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000050166
AA Change: V284I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055000
Gene: ENSMUSG00000040537
AA Change: V284I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 7.6e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.1e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.4e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 824 839 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088744
AA Change: V284I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086122
Gene: ENSMUSG00000040537
AA Change: V284I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 4.2e-29 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.2e-8 PFAM
Pfam:Reprolysin 237 436 2.9e-65 PFAM
Pfam:Reprolysin_3 261 378 9.2e-13 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 736 758 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088761
AA Change: V284I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086139
Gene: ENSMUSG00000040537
AA Change: V284I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 8.1e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.2e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.6e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 789 808 N/A INTRINSIC
low complexity region 860 875 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115385
AA Change: V284I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111043
Gene: ENSMUSG00000040537
AA Change: V284I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 40 186 5.2e-28 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin 237 333 2e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115386
AA Change: V284I

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111044
Gene: ENSMUSG00000040537
AA Change: V284I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 3.4e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 5.1e-9 PFAM
Pfam:Reprolysin 237 436 5e-59 PFAM
Pfam:Reprolysin_3 261 379 1.6e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 850 870 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115388
AA Change: V284I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111046
Gene: ENSMUSG00000040537
AA Change: V284I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 8e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.1e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.5e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 852 872 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. The protein encoded by this gene is believed to lack metalloproteinase activity due to the lack of a critical catalytic motif. Mice lacking the encoded protein exhibit severe ataxia, hypomyelination and premature death. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice exhibit severe ataxia, die before weaning and have marked hypomyelination of the peripheral nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik C A 8: 124,839,845 V279L probably damaging Het
4931417E11Rik A G 6: 73,468,886 Y227H probably benign Het
Acot6 A T 12: 84,101,126 Y52F probably damaging Het
Agl A T 3: 116,752,090 H1352Q probably benign Het
Aldh18a1 G A 19: 40,585,499 P27S probably benign Het
C1ra A G 6: 124,522,274 N473S probably benign Het
C87436 T C 6: 86,446,251 L269P probably damaging Het
Calcrl A G 2: 84,333,677 V390A probably damaging Het
Ccp110 T G 7: 118,715,528 probably null Het
Cerk A G 15: 86,149,400 V274A probably damaging Het
Chd1l A T 3: 97,580,991 S570T probably benign Het
Chst14 T A 2: 118,926,898 W83R probably damaging Het
Chsy1 A T 7: 66,171,514 D499V probably benign Het
Ckmt1 C A 2: 121,359,717 probably null Het
Cnot1 A T 8: 95,769,832 V282D probably damaging Het
Cntn3 A T 6: 102,242,013 S549T possibly damaging Het
Cntnap5c A T 17: 58,395,294 D1203V probably benign Het
Col4a4 A G 1: 82,535,770 Y169H unknown Het
Cwc22 A G 2: 77,915,530 F454S possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dhrs7 A T 12: 72,652,315 W298R possibly damaging Het
Dock7 G T 4: 98,945,246 T1906N probably damaging Het
Dpy19l3 T C 7: 35,749,778 T67A probably benign Het
Drc1 A G 5: 30,363,957 D654G possibly damaging Het
Ech1 A T 7: 28,831,839 H284L probably damaging Het
Epc1 G A 18: 6,441,175 Q8* probably null Het
Etv5 A T 16: 22,435,914 D65E probably damaging Het
F2rl3 A G 8: 72,762,906 R254G probably benign Het
Fabp5 T G 3: 10,015,110 F73L probably benign Het
Fbrs T C 7: 127,487,311 I611T probably damaging Het
Flnc T C 6: 29,433,807 S117P possibly damaging Het
Frmd4b A C 6: 97,308,673 S291A possibly damaging Het
Galnt13 A G 2: 55,060,546 Y413C probably damaging Het
Gfer A G 17: 24,695,363 Y109H possibly damaging Het
Gli2 T C 1: 118,836,524 H1299R possibly damaging Het
Gm10110 T C 14: 89,898,243 noncoding transcript Het
Gprc5a T G 6: 135,078,654 L33W probably damaging Het
Grin3a T C 4: 49,844,721 T121A probably benign Het
Grk3 A G 5: 113,015,382 V33A probably benign Het
Hc A T 2: 35,057,324 Y59* probably null Het
Hrnr A G 3: 93,332,516 I3354V unknown Het
Hyou1 C G 9: 44,389,406 T924S probably benign Het
Ifi209 T G 1: 173,637,365 H20Q probably damaging Het
Ifi44 A G 3: 151,732,534 V372A probably benign Het
Igdcc4 T A 9: 65,122,795 L328H probably damaging Het
Kif18a A G 2: 109,289,816 T155A probably benign Het
Kmt2d A G 15: 98,845,057 probably benign Het
Kri1 T C 9: 21,280,457 D281G possibly damaging Het
Larp1b T A 3: 41,034,072 M1K probably null Het
Loxhd1 A G 18: 77,402,563 D1225G probably damaging Het
Mzf1 A G 7: 13,043,270 *736Q probably null Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Ncf2 T A 1: 152,808,033 M1K probably null Het
Olfr1095 T A 2: 86,851,227 H157L probably benign Het
Olfr1100 A C 2: 86,978,619 M59R probably damaging Het
Parp12 T C 6: 39,096,640 D417G probably benign Het
Parp12 T C 6: 39,111,678 H208R probably damaging Het
Pcif1 T C 2: 164,885,683 I132T probably benign Het
Pck2 A G 14: 55,548,584 D610G possibly damaging Het
Plbd1 T C 6: 136,640,125 K185E probably benign Het
Ppp2r5a T C 1: 191,353,929 M425V probably damaging Het
Rapgef6 T A 11: 54,657,405 V805D probably damaging Het
Rprd2 C T 3: 95,763,747 probably benign Het
Ryr3 A G 2: 112,900,833 S711P probably damaging Het
Slc17a3 T A 13: 23,852,357 L212* probably null Het
Slc4a8 A G 15: 100,783,787 D41G probably benign Het
Slc9a3 T A 13: 74,158,818 V354E probably damaging Het
Spen A G 4: 141,468,943 I3632T probably damaging Het
Tesc A G 5: 118,054,849 S77G probably benign Het
Tet3 A T 6: 83,369,315 V1245D probably benign Het
Tox4 T A 14: 52,292,543 D553E possibly damaging Het
Tpmt A T 13: 47,027,283 Y193* probably null Het
Trio T C 15: 27,833,044 Y1169C probably damaging Het
Urb1 G A 16: 90,772,626 T1404I probably benign Het
Usp47 T C 7: 112,083,127 S540P probably damaging Het
Vmn1r178 A T 7: 23,894,123 M126L possibly damaging Het
Vmn1r223 T C 13: 23,250,178 F314S probably damaging Het
Vmn2r112 A T 17: 22,605,116 I451L probably benign Het
Zfc3h1 A G 10: 115,406,901 probably null Het
Zfp503 A T 14: 21,984,901 L649Q probably damaging Het
Zfp977 A C 7: 42,580,106 C332G probably damaging Het
Other mutations in Adam22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Adam22 APN 5 8127333 missense probably benign 0.44
IGL01368:Adam22 APN 5 8127411 missense probably damaging 1.00
IGL01406:Adam22 APN 5 8130212 nonsense probably null
IGL01463:Adam22 APN 5 8092790 missense probably damaging 1.00
IGL01691:Adam22 APN 5 8092742 missense probably damaging 1.00
IGL01798:Adam22 APN 5 8232604 splice site probably null
IGL01975:Adam22 APN 5 8167396 missense probably damaging 1.00
IGL02076:Adam22 APN 5 8136900 missense probably damaging 1.00
IGL02170:Adam22 APN 5 8134845 missense probably benign
IGL02189:Adam22 APN 5 8330029 missense possibly damaging 0.91
IGL02859:Adam22 APN 5 8167375 missense probably damaging 1.00
IGL03189:Adam22 APN 5 8111897 nonsense probably null
IGL03326:Adam22 APN 5 8127421 missense probably damaging 1.00
IGL03329:Adam22 APN 5 8149210 missense possibly damaging 0.48
IGL03354:Adam22 APN 5 8158890 missense possibly damaging 0.82
IGL03394:Adam22 APN 5 8167379 missense probably benign 0.00
IGL03047:Adam22 UTSW 5 8082220 missense probably damaging 1.00
R0445:Adam22 UTSW 5 8180591 intron probably benign
R0486:Adam22 UTSW 5 8330048 missense probably damaging 1.00
R0669:Adam22 UTSW 5 8143036 splice site probably benign
R0866:Adam22 UTSW 5 8082156 missense probably damaging 0.98
R1510:Adam22 UTSW 5 8152408 missense probably benign 0.06
R1562:Adam22 UTSW 5 8095007 missense probably damaging 1.00
R1903:Adam22 UTSW 5 8134525 missense probably damaging 1.00
R1939:Adam22 UTSW 5 8330015 missense probably damaging 1.00
R1998:Adam22 UTSW 5 8329995 missense probably damaging 1.00
R2012:Adam22 UTSW 5 8117634 missense probably damaging 1.00
R2214:Adam22 UTSW 5 8136805 critical splice donor site probably null
R2270:Adam22 UTSW 5 8121108 missense probably damaging 0.98
R2271:Adam22 UTSW 5 8121108 missense probably damaging 0.98
R2286:Adam22 UTSW 5 8145616 missense probably damaging 1.00
R2304:Adam22 UTSW 5 8092366 missense probably damaging 1.00
R2406:Adam22 UTSW 5 8180064 intron probably benign
R2656:Adam22 UTSW 5 8117696 missense probably damaging 1.00
R3106:Adam22 UTSW 5 8117583 splice site probably null
R3870:Adam22 UTSW 5 8132418 missense probably damaging 1.00
R3923:Adam22 UTSW 5 8130514 missense possibly damaging 0.68
R4092:Adam22 UTSW 5 8095004 missense probably damaging 1.00
R4180:Adam22 UTSW 5 8149218 missense probably damaging 1.00
R4247:Adam22 UTSW 5 8145626 missense probably benign
R4486:Adam22 UTSW 5 8180227 intron probably benign
R4629:Adam22 UTSW 5 8232663 missense possibly damaging 0.95
R4744:Adam22 UTSW 5 8078699 missense probably damaging 0.98
R4839:Adam22 UTSW 5 8136813 missense probably damaging 1.00
R5007:Adam22 UTSW 5 8167393 missense probably damaging 1.00
R5030:Adam22 UTSW 5 8179645 intron probably benign
R5061:Adam22 UTSW 5 8180238 intron probably benign
R5312:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5353:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5354:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5356:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5423:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5424:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5719:Adam22 UTSW 5 8367217 missense probably benign
R5763:Adam22 UTSW 5 8134544 missense probably damaging 1.00
R5768:Adam22 UTSW 5 8127426 missense probably benign 0.35
R5776:Adam22 UTSW 5 8127361 missense probably benign 0.26
R5839:Adam22 UTSW 5 8136861 missense probably damaging 0.99
R6314:Adam22 UTSW 5 8127365 nonsense probably null
R6520:Adam22 UTSW 5 8116635 missense probably damaging 0.98
R6798:Adam22 UTSW 5 8160784 missense probably damaging 1.00
R6924:Adam22 UTSW 5 8367322 missense possibly damaging 0.78
R6938:Adam22 UTSW 5 8146499 missense probably benign 0.01
R7317:Adam22 UTSW 5 8090202 missense probably benign
X0067:Adam22 UTSW 5 8127329 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CGGCCACATTACATCACAGTTGC -3'
(R):5'- CGGGGAAAGCCTTGAATTGAGCAC -3'

Sequencing Primer
(F):5'- TTCAGGAGTAAGCACTCAATATGG -3'
(R):5'- ACCACTTTTGTGTCTAGAATGTGC -3'
Posted On2014-04-24