Incidental Mutation 'R1640:Ccp110'
ID173469
Institutional Source Beutler Lab
Gene Symbol Ccp110
Ensembl Gene ENSMUSG00000033904
Gene Namecentriolar coiled coil protein 110
Synonyms6330503K22Rik, CP110
MMRRC Submission 039676-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.892) question?
Stock #R1640 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location118712552-118737024 bp(+) (GRCm38)
Type of Mutationsplice site (14 bp from exon)
DNA Base Change (assembly) T to G at 118715528 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038650] [ENSMUST00000106557]
Predicted Effect probably null
Transcript: ENSMUST00000038650
SMART Domains Protein: ENSMUSP00000038881
Gene: ENSMUSG00000033904

DomainStartEndE-ValueType
Pfam:CALM_bind 29 135 7.4e-21 PFAM
low complexity region 241 253 N/A INTRINSIC
low complexity region 325 337 N/A INTRINSIC
coiled coil region 642 699 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106557
SMART Domains Protein: ENSMUSP00000102167
Gene: ENSMUSG00000033904

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
low complexity region 325 337 N/A INTRINSIC
coiled coil region 642 699 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit pleiotropic phenotypes due to impaired sonic hedgehog (Shh) signaling and failure of primary cilia formation in multiple tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik C A 8: 124,839,845 V279L probably damaging Het
4931417E11Rik A G 6: 73,468,886 Y227H probably benign Het
Acot6 A T 12: 84,101,126 Y52F probably damaging Het
Adam22 C T 5: 8,145,689 V284I probably damaging Het
Agl A T 3: 116,752,090 H1352Q probably benign Het
Aldh18a1 G A 19: 40,585,499 P27S probably benign Het
C1ra A G 6: 124,522,274 N473S probably benign Het
C87436 T C 6: 86,446,251 L269P probably damaging Het
Calcrl A G 2: 84,333,677 V390A probably damaging Het
Cerk A G 15: 86,149,400 V274A probably damaging Het
Chd1l A T 3: 97,580,991 S570T probably benign Het
Chst14 T A 2: 118,926,898 W83R probably damaging Het
Chsy1 A T 7: 66,171,514 D499V probably benign Het
Ckmt1 C A 2: 121,359,717 probably null Het
Cnot1 A T 8: 95,769,832 V282D probably damaging Het
Cntn3 A T 6: 102,242,013 S549T possibly damaging Het
Cntnap5c A T 17: 58,395,294 D1203V probably benign Het
Col4a4 A G 1: 82,535,770 Y169H unknown Het
Cwc22 A G 2: 77,915,530 F454S possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dhrs7 A T 12: 72,652,315 W298R possibly damaging Het
Dock7 G T 4: 98,945,246 T1906N probably damaging Het
Dpy19l3 T C 7: 35,749,778 T67A probably benign Het
Drc1 A G 5: 30,363,957 D654G possibly damaging Het
Ech1 A T 7: 28,831,839 H284L probably damaging Het
Epc1 G A 18: 6,441,175 Q8* probably null Het
Etv5 A T 16: 22,435,914 D65E probably damaging Het
F2rl3 A G 8: 72,762,906 R254G probably benign Het
Fabp5 T G 3: 10,015,110 F73L probably benign Het
Fbrs T C 7: 127,487,311 I611T probably damaging Het
Flnc T C 6: 29,433,807 S117P possibly damaging Het
Frmd4b A C 6: 97,308,673 S291A possibly damaging Het
Galnt13 A G 2: 55,060,546 Y413C probably damaging Het
Gfer A G 17: 24,695,363 Y109H possibly damaging Het
Gli2 T C 1: 118,836,524 H1299R possibly damaging Het
Gm10110 T C 14: 89,898,243 noncoding transcript Het
Gprc5a T G 6: 135,078,654 L33W probably damaging Het
Grin3a T C 4: 49,844,721 T121A probably benign Het
Grk3 A G 5: 113,015,382 V33A probably benign Het
Hc A T 2: 35,057,324 Y59* probably null Het
Hrnr A G 3: 93,332,516 I3354V unknown Het
Hyou1 C G 9: 44,389,406 T924S probably benign Het
Ifi209 T G 1: 173,637,365 H20Q probably damaging Het
Ifi44 A G 3: 151,732,534 V372A probably benign Het
Igdcc4 T A 9: 65,122,795 L328H probably damaging Het
Kif18a A G 2: 109,289,816 T155A probably benign Het
Kmt2d A G 15: 98,845,057 probably benign Het
Kri1 T C 9: 21,280,457 D281G possibly damaging Het
Larp1b T A 3: 41,034,072 M1K probably null Het
Loxhd1 A G 18: 77,402,563 D1225G probably damaging Het
Mzf1 A G 7: 13,043,270 *736Q probably null Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Ncf2 T A 1: 152,808,033 M1K probably null Het
Olfr1095 T A 2: 86,851,227 H157L probably benign Het
Olfr1100 A C 2: 86,978,619 M59R probably damaging Het
Parp12 T C 6: 39,096,640 D417G probably benign Het
Parp12 T C 6: 39,111,678 H208R probably damaging Het
Pcif1 T C 2: 164,885,683 I132T probably benign Het
Pck2 A G 14: 55,548,584 D610G possibly damaging Het
Plbd1 T C 6: 136,640,125 K185E probably benign Het
Ppp2r5a T C 1: 191,353,929 M425V probably damaging Het
Rapgef6 T A 11: 54,657,405 V805D probably damaging Het
Rprd2 C T 3: 95,763,747 probably benign Het
Ryr3 A G 2: 112,900,833 S711P probably damaging Het
Slc17a3 T A 13: 23,852,357 L212* probably null Het
Slc4a8 A G 15: 100,783,787 D41G probably benign Het
Slc9a3 T A 13: 74,158,818 V354E probably damaging Het
Spen A G 4: 141,468,943 I3632T probably damaging Het
Tesc A G 5: 118,054,849 S77G probably benign Het
Tet3 A T 6: 83,369,315 V1245D probably benign Het
Tox4 T A 14: 52,292,543 D553E possibly damaging Het
Tpmt A T 13: 47,027,283 Y193* probably null Het
Trio T C 15: 27,833,044 Y1169C probably damaging Het
Urb1 G A 16: 90,772,626 T1404I probably benign Het
Usp47 T C 7: 112,083,127 S540P probably damaging Het
Vmn1r178 A T 7: 23,894,123 M126L possibly damaging Het
Vmn1r223 T C 13: 23,250,178 F314S probably damaging Het
Vmn2r112 A T 17: 22,605,116 I451L probably benign Het
Zfc3h1 A G 10: 115,406,901 probably null Het
Zfp503 A T 14: 21,984,901 L649Q probably damaging Het
Zfp977 A C 7: 42,580,106 C332G probably damaging Het
Other mutations in Ccp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ccp110 APN 7 118722424 missense possibly damaging 0.79
IGL00481:Ccp110 APN 7 118729997 missense possibly damaging 0.70
IGL00725:Ccp110 APN 7 118730723 missense probably damaging 0.99
IGL00899:Ccp110 APN 7 118722684 missense probably benign
IGL01837:Ccp110 APN 7 118725461 critical splice donor site probably null
PIT4469001:Ccp110 UTSW 7 118722377 missense probably benign 0.06
R1217:Ccp110 UTSW 7 118729944 splice site probably benign
R1700:Ccp110 UTSW 7 118735313 missense probably damaging 0.99
R1768:Ccp110 UTSW 7 118726024 unclassified probably null
R4737:Ccp110 UTSW 7 118724548 missense possibly damaging 0.96
R4859:Ccp110 UTSW 7 118725430 missense possibly damaging 0.93
R4933:Ccp110 UTSW 7 118725319 missense probably damaging 0.96
R4970:Ccp110 UTSW 7 118722391 missense possibly damaging 0.85
R4999:Ccp110 UTSW 7 118730012 nonsense probably null
R5212:Ccp110 UTSW 7 118729696 missense probably damaging 0.99
R5600:Ccp110 UTSW 7 118729725 critical splice donor site probably null
R6953:Ccp110 UTSW 7 118722421 missense possibly damaging 0.85
R6998:Ccp110 UTSW 7 118732897 missense possibly damaging 0.91
R7076:Ccp110 UTSW 7 118732405 missense probably damaging 1.00
R7092:Ccp110 UTSW 7 118735271 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TGAAGTTGCCTAGTGACCTCTCAGG -3'
(R):5'- CCATTGGATTTTCAGTGAGCTGCG -3'

Sequencing Primer
(F):5'- ttaataaataaaatCCCCAGAGCCAG -3'
(R):5'- TAGGGGAggagagataactccaac -3'
Posted On2014-04-24