Incidental Mutation 'R1641:Traf5'
ID173511
Institutional Source Beutler Lab
Gene Symbol Traf5
Ensembl Gene ENSMUSG00000026637
Gene NameTNF receptor-associated factor 5
Synonyms
MMRRC Submission 039677-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1641 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location191997205-192092559 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 191997509 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 527 (N527I)
Ref Sequence ENSEMBL: ENSMUSP00000082710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085573]
Predicted Effect probably benign
Transcript: ENSMUST00000085573
AA Change: N527I

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000082710
Gene: ENSMUSG00000026637
AA Change: N527I

DomainStartEndE-ValueType
RING 45 84 1.74e-4 SMART
Pfam:zf-TRAF 128 183 4.8e-21 PFAM
Pfam:zf-TRAF 183 241 4.2e-19 PFAM
MATH 402 525 2.42e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175262
Predicted Effect unknown
Transcript: ENSMUST00000192628
AA Change: N224I
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195647
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The scaffold protein encoded by this gene is a member of the tumor necrosis factor receptor-associated factor (TRAF) protein family and contains a meprin and TRAF homology (MATH) domain, a RING-type zinc finger, and two TRAF-type zinc fingers. TRAF proteins are associated with, and mediate signal transduction from members of the TNF receptor superfamily. This protein is one of the components of a multiple protein complex which binds to tumor necrosis factor (TNF) receptor cytoplasmic domains and mediates TNF-induced activation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice show defects in lymphocyte activation but are otherwise viable and develop normally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,228,959 T2230A probably benign Het
Aasdh T A 5: 76,891,779 T228S probably benign Het
Adamts2 C T 11: 50,792,785 P965S probably damaging Het
Ankrd11 A G 8: 122,891,746 I1768T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Baz2b A T 2: 59,912,890 L1579Q probably damaging Het
Btbd7 A G 12: 102,790,775 V684A probably damaging Het
Camk1g T A 1: 193,356,357 I86F probably benign Het
Capn13 A T 17: 73,382,894 S41T possibly damaging Het
Cep192 C A 18: 67,847,433 L1422I probably damaging Het
Chaf1a T C 17: 56,047,380 F217L unknown Het
Clca3b A T 3: 144,823,513 M800K possibly damaging Het
Crocc A G 4: 141,017,077 V1836A probably benign Het
Csmd2 G A 4: 128,483,395 V2023M possibly damaging Het
Cul9 A G 17: 46,543,560 V72A possibly damaging Het
Ddx52 T C 11: 83,943,443 probably null Het
Dennd5b A C 6: 149,068,205 V250G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gtpbp4 A T 13: 8,973,249 M593K probably benign Het
Il21 A G 3: 37,232,532 F12L probably benign Het
Lrit2 T A 14: 37,069,148 N261K probably benign Het
Lrrc39 G T 3: 116,570,913 C151F probably damaging Het
Lsm14a C A 7: 34,351,374 R426L probably damaging Het
Maml1 G A 11: 50,266,947 P134S probably benign Het
Map3k13 T C 16: 21,903,792 C235R probably damaging Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nsmaf T C 4: 6,409,884 E663G probably benign Het
Ntrk3 T C 7: 78,356,074 N513S probably damaging Het
Nufip1 T G 14: 76,126,252 N305K possibly damaging Het
Olfr121 C T 17: 37,752,025 T57I possibly damaging Het
Olfr1257 A T 2: 89,881,401 T192S probably benign Het
Olfr575 T A 7: 102,954,968 D218V probably benign Het
Olfr694 T A 7: 106,689,711 T7S probably benign Het
Olfr823 A T 10: 130,112,003 Y262* probably null Het
Pi4ka A G 16: 17,377,030 V168A probably benign Het
Prex2 T C 1: 11,231,772 V1433A probably damaging Het
Prl7a1 A T 13: 27,633,629 D217E probably damaging Het
Prr3 G A 17: 35,974,592 R86* probably null Het
Ptprz1 T C 6: 23,049,606 F1350L probably damaging Het
R3hcc1l T C 19: 42,563,607 S348P possibly damaging Het
Rag2 A T 2: 101,629,615 Q90L probably benign Het
Scel T C 14: 103,533,316 L62P probably damaging Het
Serpini1 A T 3: 75,614,670 E156V possibly damaging Het
Skint4 T A 4: 112,136,043 I321K possibly damaging Het
Slc28a2 A G 2: 122,455,617 D478G probably damaging Het
Sppl2b G T 10: 80,865,131 V164F probably damaging Het
Ttc3 T A 16: 94,443,317 D17E probably benign Het
Txlnb G A 10: 17,806,773 A148T possibly damaging Het
Ubtf A G 11: 102,310,931 Y256H probably damaging Het
Usp25 T C 16: 77,071,671 F320S possibly damaging Het
Utp14b T C 1: 78,665,939 V518A probably benign Het
Utp20 A G 10: 88,757,972 V2192A possibly damaging Het
Vmn1r173 T A 7: 23,703,108 M256K probably benign Het
Vmn2r114 T A 17: 23,296,988 M510L probably benign Het
Xdh T A 17: 73,926,552 Q189L probably benign Het
Zfat C T 15: 68,180,110 A605T probably benign Het
Other mutations in Traf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Traf5 APN 1 192057174 missense possibly damaging 0.95
IGL01462:Traf5 APN 1 191999867 missense probably benign
IGL02262:Traf5 APN 1 191997675 missense probably damaging 1.00
IGL02579:Traf5 APN 1 191999887 missense probably damaging 0.99
IGL03308:Traf5 APN 1 191997500 missense probably damaging 0.99
PIT4445001:Traf5 UTSW 1 191997807 missense
R0028:Traf5 UTSW 1 192074121 intron probably benign
R0689:Traf5 UTSW 1 191997876 missense probably benign 0.16
R1511:Traf5 UTSW 1 191999951 missense probably benign 0.01
R2235:Traf5 UTSW 1 192054391 missense probably damaging 1.00
R2246:Traf5 UTSW 1 192066890 splice site probably null
R2301:Traf5 UTSW 1 191997965 missense probably benign 0.01
R3973:Traf5 UTSW 1 191997876 missense probably benign 0.16
R4396:Traf5 UTSW 1 191997845 missense probably benign 0.22
R4793:Traf5 UTSW 1 191997804 missense probably benign 0.38
R4834:Traf5 UTSW 1 192066898 missense probably benign 0.10
R5779:Traf5 UTSW 1 191997672 missense probably damaging 1.00
R5795:Traf5 UTSW 1 191999846 missense probably benign 0.00
R5843:Traf5 UTSW 1 191997485 missense possibly damaging 0.55
R5912:Traf5 UTSW 1 191998069 intron probably benign
R5963:Traf5 UTSW 1 192000016 missense probably benign 0.06
R6246:Traf5 UTSW 1 192070553 missense probably damaging 0.99
R6287:Traf5 UTSW 1 191999872 missense probably damaging 1.00
R6455:Traf5 UTSW 1 191999926 missense probably benign 0.00
R7248:Traf5 UTSW 1 192059017 missense probably benign 0.20
R7452:Traf5 UTSW 1 191999831 missense
Predicted Primers PCR Primer
(F):5'- TTGAGCACTGGACTCCCTGAAAAC -3'
(R):5'- AGGGTGACCCTGATGCTTTTGGAC -3'

Sequencing Primer
(F):5'- CTTCCCAGACTTCAGTGAGAGAG -3'
(R):5'- TTTTGGACCAGAGCGGC -3'
Posted On2014-04-24