Incidental Mutation 'R1641:Il21'
ID173518
Institutional Source Beutler Lab
Gene Symbol Il21
Ensembl Gene ENSMUSG00000027718
Gene Nameinterleukin 21
Synonyms
MMRRC Submission 039677-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1641 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location37222759-37232636 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37232532 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 12 (F12L)
Ref Sequence ENSEMBL: ENSMUSP00000124668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029273] [ENSMUST00000161015]
Predicted Effect probably benign
Transcript: ENSMUST00000029273
AA Change: F12L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029273
Gene: ENSMUSG00000027718
AA Change: F12L

DomainStartEndE-ValueType
Pfam:IL15 4 142 7.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147691
Predicted Effect probably benign
Transcript: ENSMUST00000161015
AA Change: F12L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000124668
Gene: ENSMUSG00000027718
AA Change: F12L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 26 38 N/A INTRINSIC
PDB:3TGX|P 39 140 8e-36 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200285
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the common-gamma chain family of cytokines with immunoregulatory activity. The encoded protein plays a role in both the innate and adaptive immune responses by inducing the differentiation, proliferation and activity of multiple target cells including macrophages, natural killer cells, B cells and cytotoxic T cells. Dysregulation of this gene plays a role in multiple immune-mediated diseases including lupus, psoriasis and chronic inflammatory diseases. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene develop normally and have a normal life span. One allele exhibits enhanced IgE isotype switch and IgE production after antigen immunization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,228,959 T2230A probably benign Het
Aasdh T A 5: 76,891,779 T228S probably benign Het
Adamts2 C T 11: 50,792,785 P965S probably damaging Het
Ankrd11 A G 8: 122,891,746 I1768T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Baz2b A T 2: 59,912,890 L1579Q probably damaging Het
Btbd7 A G 12: 102,790,775 V684A probably damaging Het
Camk1g T A 1: 193,356,357 I86F probably benign Het
Capn13 A T 17: 73,382,894 S41T possibly damaging Het
Cep192 C A 18: 67,847,433 L1422I probably damaging Het
Chaf1a T C 17: 56,047,380 F217L unknown Het
Clca3b A T 3: 144,823,513 M800K possibly damaging Het
Crocc A G 4: 141,017,077 V1836A probably benign Het
Csmd2 G A 4: 128,483,395 V2023M possibly damaging Het
Cul9 A G 17: 46,543,560 V72A possibly damaging Het
Ddx52 T C 11: 83,943,443 probably null Het
Dennd5b A C 6: 149,068,205 V250G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gtpbp4 A T 13: 8,973,249 M593K probably benign Het
Lrit2 T A 14: 37,069,148 N261K probably benign Het
Lrrc39 G T 3: 116,570,913 C151F probably damaging Het
Lsm14a C A 7: 34,351,374 R426L probably damaging Het
Maml1 G A 11: 50,266,947 P134S probably benign Het
Map3k13 T C 16: 21,903,792 C235R probably damaging Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nsmaf T C 4: 6,409,884 E663G probably benign Het
Ntrk3 T C 7: 78,356,074 N513S probably damaging Het
Nufip1 T G 14: 76,126,252 N305K possibly damaging Het
Olfr121 C T 17: 37,752,025 T57I possibly damaging Het
Olfr1257 A T 2: 89,881,401 T192S probably benign Het
Olfr575 T A 7: 102,954,968 D218V probably benign Het
Olfr694 T A 7: 106,689,711 T7S probably benign Het
Olfr823 A T 10: 130,112,003 Y262* probably null Het
Pi4ka A G 16: 17,377,030 V168A probably benign Het
Prex2 T C 1: 11,231,772 V1433A probably damaging Het
Prl7a1 A T 13: 27,633,629 D217E probably damaging Het
Prr3 G A 17: 35,974,592 R86* probably null Het
Ptprz1 T C 6: 23,049,606 F1350L probably damaging Het
R3hcc1l T C 19: 42,563,607 S348P possibly damaging Het
Rag2 A T 2: 101,629,615 Q90L probably benign Het
Scel T C 14: 103,533,316 L62P probably damaging Het
Serpini1 A T 3: 75,614,670 E156V possibly damaging Het
Skint4 T A 4: 112,136,043 I321K possibly damaging Het
Slc28a2 A G 2: 122,455,617 D478G probably damaging Het
Sppl2b G T 10: 80,865,131 V164F probably damaging Het
Traf5 T A 1: 191,997,509 N527I probably benign Het
Ttc3 T A 16: 94,443,317 D17E probably benign Het
Txlnb G A 10: 17,806,773 A148T possibly damaging Het
Ubtf A G 11: 102,310,931 Y256H probably damaging Het
Usp25 T C 16: 77,071,671 F320S possibly damaging Het
Utp14b T C 1: 78,665,939 V518A probably benign Het
Utp20 A G 10: 88,757,972 V2192A possibly damaging Het
Vmn1r173 T A 7: 23,703,108 M256K probably benign Het
Vmn2r114 T A 17: 23,296,988 M510L probably benign Het
Xdh T A 17: 73,926,552 Q189L probably benign Het
Zfat C T 15: 68,180,110 A605T probably benign Het
Other mutations in Il21
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0433:Il21 UTSW 3 37232535 missense possibly damaging 0.46
R0579:Il21 UTSW 3 37227774 missense possibly damaging 0.65
R1741:Il21 UTSW 3 37227662 missense probably benign 0.00
R1754:Il21 UTSW 3 37225525 missense possibly damaging 0.93
R1933:Il21 UTSW 3 37232486 missense probably benign
R4560:Il21 UTSW 3 37225484 nonsense probably null
R4975:Il21 UTSW 3 37232504 missense probably damaging 0.99
R4977:Il21 UTSW 3 37232504 missense probably damaging 0.99
R4979:Il21 UTSW 3 37232504 missense probably damaging 0.99
R5254:Il21 UTSW 3 37227735 missense possibly damaging 0.94
R5267:Il21 UTSW 3 37227797 missense probably benign
R5641:Il21 UTSW 3 37227768 nonsense probably null
R7058:Il21 UTSW 3 37232480 missense probably damaging 1.00
R7259:Il21 UTSW 3 37227654 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTTGGTGATACAAGTCAAAAGGCTCC -3'
(R):5'- CTGTCAGACAAACCAGGTGAGGTG -3'

Sequencing Primer
(F):5'- GTGACAAACATGGCCTTACCA -3'
(R):5'- Ccacacacacacacacacac -3'
Posted On2014-04-24