Incidental Mutation 'R1641:Serpini1'
ID173519
Institutional Source Beutler Lab
Gene Symbol Serpini1
Ensembl Gene ENSMUSG00000027834
Gene Nameserine (or cysteine) peptidase inhibitor, clade I, member 1
SynonymsNeuroserpin, Spi17, Ns, PI12
MMRRC Submission 039677-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R1641 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location75557547-75643495 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75614670 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 156 (E156V)
Ref Sequence ENSEMBL: ENSMUSP00000123845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029423] [ENSMUST00000161776]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029423
AA Change: E156V

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029423
Gene: ENSMUSG00000027834
AA Change: E156V

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
SERPIN 31 397 1.46e-158 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161695
Predicted Effect possibly damaging
Transcript: ENSMUST00000161776
AA Change: E156V

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123845
Gene: ENSMUSG00000027834
AA Change: E156V

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
SERPIN 31 207 1.15e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195285
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serpin superfamily of serine proteinase inhibitors. The protein is primarily secreted by axons in the brain, and preferentially reacts with and inhibits tissue-type plasminogen activator. It is thought to play a role in the regulation of axonal growth and the development of synaptic plasticity. Mutations in this gene result in familial encephalopathy with neuroserpin inclusion bodies (FENIB), which is a dominantly inherited form of familial encephalopathy and epilepsy characterized by the accumulation of mutant neuroserpin polymers. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene show no change in brain morphology or histology. However, they show an increase avoidance of novel stimuli and increased anxiety responses in some situations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,228,959 T2230A probably benign Het
Aasdh T A 5: 76,891,779 T228S probably benign Het
Adamts2 C T 11: 50,792,785 P965S probably damaging Het
Ankrd11 A G 8: 122,891,746 I1768T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Baz2b A T 2: 59,912,890 L1579Q probably damaging Het
Btbd7 A G 12: 102,790,775 V684A probably damaging Het
Camk1g T A 1: 193,356,357 I86F probably benign Het
Capn13 A T 17: 73,382,894 S41T possibly damaging Het
Cep192 C A 18: 67,847,433 L1422I probably damaging Het
Chaf1a T C 17: 56,047,380 F217L unknown Het
Clca3b A T 3: 144,823,513 M800K possibly damaging Het
Crocc A G 4: 141,017,077 V1836A probably benign Het
Csmd2 G A 4: 128,483,395 V2023M possibly damaging Het
Cul9 A G 17: 46,543,560 V72A possibly damaging Het
Ddx52 T C 11: 83,943,443 probably null Het
Dennd5b A C 6: 149,068,205 V250G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gtpbp4 A T 13: 8,973,249 M593K probably benign Het
Il21 A G 3: 37,232,532 F12L probably benign Het
Lrit2 T A 14: 37,069,148 N261K probably benign Het
Lrrc39 G T 3: 116,570,913 C151F probably damaging Het
Lsm14a C A 7: 34,351,374 R426L probably damaging Het
Maml1 G A 11: 50,266,947 P134S probably benign Het
Map3k13 T C 16: 21,903,792 C235R probably damaging Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nsmaf T C 4: 6,409,884 E663G probably benign Het
Ntrk3 T C 7: 78,356,074 N513S probably damaging Het
Nufip1 T G 14: 76,126,252 N305K possibly damaging Het
Olfr121 C T 17: 37,752,025 T57I possibly damaging Het
Olfr1257 A T 2: 89,881,401 T192S probably benign Het
Olfr575 T A 7: 102,954,968 D218V probably benign Het
Olfr694 T A 7: 106,689,711 T7S probably benign Het
Olfr823 A T 10: 130,112,003 Y262* probably null Het
Pi4ka A G 16: 17,377,030 V168A probably benign Het
Prex2 T C 1: 11,231,772 V1433A probably damaging Het
Prl7a1 A T 13: 27,633,629 D217E probably damaging Het
Prr3 G A 17: 35,974,592 R86* probably null Het
Ptprz1 T C 6: 23,049,606 F1350L probably damaging Het
R3hcc1l T C 19: 42,563,607 S348P possibly damaging Het
Rag2 A T 2: 101,629,615 Q90L probably benign Het
Scel T C 14: 103,533,316 L62P probably damaging Het
Skint4 T A 4: 112,136,043 I321K possibly damaging Het
Slc28a2 A G 2: 122,455,617 D478G probably damaging Het
Sppl2b G T 10: 80,865,131 V164F probably damaging Het
Traf5 T A 1: 191,997,509 N527I probably benign Het
Ttc3 T A 16: 94,443,317 D17E probably benign Het
Txlnb G A 10: 17,806,773 A148T possibly damaging Het
Ubtf A G 11: 102,310,931 Y256H probably damaging Het
Usp25 T C 16: 77,071,671 F320S possibly damaging Het
Utp14b T C 1: 78,665,939 V518A probably benign Het
Utp20 A G 10: 88,757,972 V2192A possibly damaging Het
Vmn1r173 T A 7: 23,703,108 M256K probably benign Het
Vmn2r114 T A 17: 23,296,988 M510L probably benign Het
Xdh T A 17: 73,926,552 Q189L probably benign Het
Zfat C T 15: 68,180,110 A605T probably benign Het
Other mutations in Serpini1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Serpini1 APN 3 75640695 nonsense probably null
IGL02131:Serpini1 APN 3 75640704 missense probably benign 0.15
IGL02265:Serpini1 APN 3 75619269 missense probably damaging 0.96
IGL03151:Serpini1 APN 3 75613296 missense probably benign 0.00
IGL03232:Serpini1 APN 3 75638010 splice site probably benign
IGL03256:Serpini1 APN 3 75619174 missense probably benign 0.04
R0021:Serpini1 UTSW 3 75619313 missense probably damaging 1.00
R0021:Serpini1 UTSW 3 75619313 missense probably damaging 1.00
R0449:Serpini1 UTSW 3 75613341 missense probably benign 0.06
R0941:Serpini1 UTSW 3 75616627 missense probably damaging 0.97
R1968:Serpini1 UTSW 3 75614478 missense probably benign 0.34
R1993:Serpini1 UTSW 3 75614664 missense probably damaging 1.00
R2159:Serpini1 UTSW 3 75623944 missense probably benign 0.06
R3418:Serpini1 UTSW 3 75640282 missense probably damaging 1.00
R3419:Serpini1 UTSW 3 75640282 missense probably damaging 1.00
R3780:Serpini1 UTSW 3 75614635 missense probably damaging 0.96
R4618:Serpini1 UTSW 3 75616576 missense probably benign 0.29
R4864:Serpini1 UTSW 3 75613174 missense probably benign 0.01
R4989:Serpini1 UTSW 3 75614488 missense probably benign 0.07
R5080:Serpini1 UTSW 3 75616660 missense probably damaging 1.00
R5324:Serpini1 UTSW 3 75640294 missense probably damaging 1.00
R5767:Serpini1 UTSW 3 75613081 splice site probably benign
R5817:Serpini1 UTSW 3 75613324 missense probably benign 0.07
R5912:Serpini1 UTSW 3 75616607 missense probably benign 0.04
R5944:Serpini1 UTSW 3 75640299 missense probably damaging 1.00
R6704:Serpini1 UTSW 3 75637948 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGGCCTCTGCCGAAGAAAACC -3'
(R):5'- TCCCTCTGTGGCTTTAAAACCAAGG -3'

Sequencing Primer
(F):5'- TCTGCCGAAGAAAACCAATATGTG -3'
(R):5'- GTGGCTTTAAAACCAAGGCATATC -3'
Posted On2014-04-24