Incidental Mutation 'R1641:Nsmaf'
ID173522
Institutional Source Beutler Lab
Gene Symbol Nsmaf
Ensembl Gene ENSMUSG00000028245
Gene Nameneutral sphingomyelinase (N-SMase) activation associated factor
SynonymsFan, factor associated with N-SMase activation
MMRRC Submission 039677-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R1641 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location6396207-6454271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6409884 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 663 (E663G)
Ref Sequence ENSEMBL: ENSMUSP00000029910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029910] [ENSMUST00000108374]
Predicted Effect probably benign
Transcript: ENSMUST00000029910
AA Change: E663G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000029910
Gene: ENSMUSG00000028245
AA Change: E663G

DomainStartEndE-ValueType
low complexity region 23 28 N/A INTRINSIC
GRAM 176 247 2.22e-11 SMART
Beach 302 575 6.28e-190 SMART
WD40 622 661 4.55e-3 SMART
WD40 664 703 2.97e0 SMART
WD40 706 743 1.47e-6 SMART
WD40 756 794 1.7e-2 SMART
WD40 797 836 1.02e-5 SMART
WD40 839 875 9.55e0 SMART
WD40 878 917 1.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108374
SMART Domains Protein: ENSMUSP00000104011
Gene: ENSMUSG00000028249

DomainStartEndE-ValueType
PDZ 124 195 2.84e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156715
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD-repeat protein that binds the cytoplasmic sphingomyelinase activation domain of the 55kD tumor necrosis factor receptor. This protein is required for TNF-mediated activation of neutral sphingomyelinase and may play a role in regulating TNF-induced cellular responses such as inflammation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation show no gross phenotypic abnormalities but display delayed cutaneous barrier repair. In addition, D-galactosamine-sensitized homozygotes are partially resistant to LPS- and TNF-induced lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,228,959 T2230A probably benign Het
Aasdh T A 5: 76,891,779 T228S probably benign Het
Adamts2 C T 11: 50,792,785 P965S probably damaging Het
Ankrd11 A G 8: 122,891,746 I1768T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Baz2b A T 2: 59,912,890 L1579Q probably damaging Het
Btbd7 A G 12: 102,790,775 V684A probably damaging Het
Camk1g T A 1: 193,356,357 I86F probably benign Het
Capn13 A T 17: 73,382,894 S41T possibly damaging Het
Cep192 C A 18: 67,847,433 L1422I probably damaging Het
Chaf1a T C 17: 56,047,380 F217L unknown Het
Clca3b A T 3: 144,823,513 M800K possibly damaging Het
Crocc A G 4: 141,017,077 V1836A probably benign Het
Csmd2 G A 4: 128,483,395 V2023M possibly damaging Het
Cul9 A G 17: 46,543,560 V72A possibly damaging Het
Ddx52 T C 11: 83,943,443 probably null Het
Dennd5b A C 6: 149,068,205 V250G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gtpbp4 A T 13: 8,973,249 M593K probably benign Het
Il21 A G 3: 37,232,532 F12L probably benign Het
Lrit2 T A 14: 37,069,148 N261K probably benign Het
Lrrc39 G T 3: 116,570,913 C151F probably damaging Het
Lsm14a C A 7: 34,351,374 R426L probably damaging Het
Maml1 G A 11: 50,266,947 P134S probably benign Het
Map3k13 T C 16: 21,903,792 C235R probably damaging Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Ntrk3 T C 7: 78,356,074 N513S probably damaging Het
Nufip1 T G 14: 76,126,252 N305K possibly damaging Het
Olfr121 C T 17: 37,752,025 T57I possibly damaging Het
Olfr1257 A T 2: 89,881,401 T192S probably benign Het
Olfr575 T A 7: 102,954,968 D218V probably benign Het
Olfr694 T A 7: 106,689,711 T7S probably benign Het
Olfr823 A T 10: 130,112,003 Y262* probably null Het
Pi4ka A G 16: 17,377,030 V168A probably benign Het
Prex2 T C 1: 11,231,772 V1433A probably damaging Het
Prl7a1 A T 13: 27,633,629 D217E probably damaging Het
Prr3 G A 17: 35,974,592 R86* probably null Het
Ptprz1 T C 6: 23,049,606 F1350L probably damaging Het
R3hcc1l T C 19: 42,563,607 S348P possibly damaging Het
Rag2 A T 2: 101,629,615 Q90L probably benign Het
Scel T C 14: 103,533,316 L62P probably damaging Het
Serpini1 A T 3: 75,614,670 E156V possibly damaging Het
Skint4 T A 4: 112,136,043 I321K possibly damaging Het
Slc28a2 A G 2: 122,455,617 D478G probably damaging Het
Sppl2b G T 10: 80,865,131 V164F probably damaging Het
Traf5 T A 1: 191,997,509 N527I probably benign Het
Ttc3 T A 16: 94,443,317 D17E probably benign Het
Txlnb G A 10: 17,806,773 A148T possibly damaging Het
Ubtf A G 11: 102,310,931 Y256H probably damaging Het
Usp25 T C 16: 77,071,671 F320S possibly damaging Het
Utp14b T C 1: 78,665,939 V518A probably benign Het
Utp20 A G 10: 88,757,972 V2192A possibly damaging Het
Vmn1r173 T A 7: 23,703,108 M256K probably benign Het
Vmn2r114 T A 17: 23,296,988 M510L probably benign Het
Xdh T A 17: 73,926,552 Q189L probably benign Het
Zfat C T 15: 68,180,110 A605T probably benign Het
Other mutations in Nsmaf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:Nsmaf APN 4 6417163 critical splice donor site probably null
IGL00778:Nsmaf APN 4 6435056 critical splice donor site probably null
IGL01775:Nsmaf APN 4 6396791 missense possibly damaging 0.79
IGL02003:Nsmaf APN 4 6418522 missense probably benign 0.02
IGL02039:Nsmaf APN 4 6424995 splice site probably benign
IGL02085:Nsmaf APN 4 6398551 missense probably benign 0.21
IGL02252:Nsmaf APN 4 6398378 missense probably benign 0.00
IGL02655:Nsmaf APN 4 6424933 missense possibly damaging 0.94
R0023:Nsmaf UTSW 4 6408680 missense probably damaging 0.96
R0454:Nsmaf UTSW 4 6424874 splice site probably null
R0538:Nsmaf UTSW 4 6419930 splice site probably null
R0605:Nsmaf UTSW 4 6418470 critical splice donor site probably null
R1033:Nsmaf UTSW 4 6438054 missense probably damaging 1.00
R1472:Nsmaf UTSW 4 6423448 nonsense probably null
R1519:Nsmaf UTSW 4 6438062 missense probably benign 0.06
R1668:Nsmaf UTSW 4 6398880 missense probably damaging 0.98
R2212:Nsmaf UTSW 4 6396732 missense probably damaging 0.99
R2351:Nsmaf UTSW 4 6437921 missense probably damaging 1.00
R3862:Nsmaf UTSW 4 6435064 missense probably benign 0.00
R4112:Nsmaf UTSW 4 6417188 nonsense probably null
R4644:Nsmaf UTSW 4 6419940 splice site probably benign
R4807:Nsmaf UTSW 4 6398542 splice site probably null
R4960:Nsmaf UTSW 4 6423342 missense probably damaging 1.00
R5556:Nsmaf UTSW 4 6398621 missense probably benign 0.00
R5936:Nsmaf UTSW 4 6421017 intron probably benign
R7288:Nsmaf UTSW 4 6416641 missense probably benign
R7295:Nsmaf UTSW 4 6438083 missense probably benign 0.00
R7378:Nsmaf UTSW 4 6416586 missense probably benign
X0021:Nsmaf UTSW 4 6398543 critical splice donor site probably null
X0063:Nsmaf UTSW 4 6414962 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAATACACTGACCCATCTTGATGCCTC -3'
(R):5'- ACTGTTGGCAAGGTCTCAGACTATTCT -3'

Sequencing Primer
(F):5'- cctccctccttcctgcc -3'
(R):5'- AATGTCACTGATGCTGCCCT -3'
Posted On2014-04-24