Incidental Mutation 'R1641:Arsi'
ID173573
Institutional Source Beutler Lab
Gene Symbol Arsi
Ensembl Gene ENSMUSG00000036412
Gene Namearylsulfatase i
Synonyms
MMRRC Submission 039677-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R1641 (G1)
Quality Score186
Status Not validated
Chromosome18
Chromosomal Location60911780-60918561 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 60916651 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 202 (G202E)
Ref Sequence ENSEMBL: ENSMUSP00000043966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040359]
Predicted Effect probably benign
Transcript: ENSMUST00000040359
AA Change: G202E

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000043966
Gene: ENSMUSG00000036412
AA Change: G202E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Sulfatase 47 360 8.2e-73 PFAM
low complexity region 526 537 N/A INTRINSIC
low complexity region 547 556 N/A INTRINSIC
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a large family of sulfatases that hydrolyze sulfate esters and sulfamates. Members of this family play a role in several cellular processes, including hormone synthesis, cell signaling in development and degradation of macromolecules. The protein encoded by this gene is thought to be secreted, and to function in extracellular space. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,228,959 T2230A probably benign Het
Aasdh T A 5: 76,891,779 T228S probably benign Het
Adamts2 C T 11: 50,792,785 P965S probably damaging Het
Ankrd11 A G 8: 122,891,746 I1768T probably benign Het
Baz2b A T 2: 59,912,890 L1579Q probably damaging Het
Btbd7 A G 12: 102,790,775 V684A probably damaging Het
Camk1g T A 1: 193,356,357 I86F probably benign Het
Capn13 A T 17: 73,382,894 S41T possibly damaging Het
Cep192 C A 18: 67,847,433 L1422I probably damaging Het
Chaf1a T C 17: 56,047,380 F217L unknown Het
Clca3b A T 3: 144,823,513 M800K possibly damaging Het
Crocc A G 4: 141,017,077 V1836A probably benign Het
Csmd2 G A 4: 128,483,395 V2023M possibly damaging Het
Cul9 A G 17: 46,543,560 V72A possibly damaging Het
Ddx52 T C 11: 83,943,443 probably null Het
Dennd5b A C 6: 149,068,205 V250G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gtpbp4 A T 13: 8,973,249 M593K probably benign Het
Il21 A G 3: 37,232,532 F12L probably benign Het
Lrit2 T A 14: 37,069,148 N261K probably benign Het
Lrrc39 G T 3: 116,570,913 C151F probably damaging Het
Lsm14a C A 7: 34,351,374 R426L probably damaging Het
Maml1 G A 11: 50,266,947 P134S probably benign Het
Map3k13 T C 16: 21,903,792 C235R probably damaging Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nsmaf T C 4: 6,409,884 E663G probably benign Het
Ntrk3 T C 7: 78,356,074 N513S probably damaging Het
Nufip1 T G 14: 76,126,252 N305K possibly damaging Het
Olfr121 C T 17: 37,752,025 T57I possibly damaging Het
Olfr1257 A T 2: 89,881,401 T192S probably benign Het
Olfr575 T A 7: 102,954,968 D218V probably benign Het
Olfr694 T A 7: 106,689,711 T7S probably benign Het
Olfr823 A T 10: 130,112,003 Y262* probably null Het
Pi4ka A G 16: 17,377,030 V168A probably benign Het
Prex2 T C 1: 11,231,772 V1433A probably damaging Het
Prl7a1 A T 13: 27,633,629 D217E probably damaging Het
Prr3 G A 17: 35,974,592 R86* probably null Het
Ptprz1 T C 6: 23,049,606 F1350L probably damaging Het
R3hcc1l T C 19: 42,563,607 S348P possibly damaging Het
Rag2 A T 2: 101,629,615 Q90L probably benign Het
Scel T C 14: 103,533,316 L62P probably damaging Het
Serpini1 A T 3: 75,614,670 E156V possibly damaging Het
Skint4 T A 4: 112,136,043 I321K possibly damaging Het
Slc28a2 A G 2: 122,455,617 D478G probably damaging Het
Sppl2b G T 10: 80,865,131 V164F probably damaging Het
Traf5 T A 1: 191,997,509 N527I probably benign Het
Ttc3 T A 16: 94,443,317 D17E probably benign Het
Txlnb G A 10: 17,806,773 A148T possibly damaging Het
Ubtf A G 11: 102,310,931 Y256H probably damaging Het
Usp25 T C 16: 77,071,671 F320S possibly damaging Het
Utp14b T C 1: 78,665,939 V518A probably benign Het
Utp20 A G 10: 88,757,972 V2192A possibly damaging Het
Vmn1r173 T A 7: 23,703,108 M256K probably benign Het
Vmn2r114 T A 17: 23,296,988 M510L probably benign Het
Xdh T A 17: 73,926,552 Q189L probably benign Het
Zfat C T 15: 68,180,110 A605T probably benign Het
Other mutations in Arsi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Arsi APN 18 60912430 missense probably damaging 1.00
IGL02519:Arsi APN 18 60917067 missense probably damaging 1.00
IGL03186:Arsi APN 18 60917473 missense probably damaging 1.00
IGL03134:Arsi UTSW 18 60917352 missense probably damaging 1.00
R0003:Arsi UTSW 18 60916986 missense probably benign 0.29
R0003:Arsi UTSW 18 60916986 missense probably benign 0.29
R0448:Arsi UTSW 18 60917302 missense probably damaging 0.98
R1147:Arsi UTSW 18 60916651 missense probably benign 0.07
R1147:Arsi UTSW 18 60916651 missense probably benign 0.07
R1148:Arsi UTSW 18 60916651 missense probably benign 0.07
R1148:Arsi UTSW 18 60916651 missense probably benign 0.07
R1190:Arsi UTSW 18 60916651 missense probably benign 0.07
R1261:Arsi UTSW 18 60916671 missense probably damaging 1.00
R1511:Arsi UTSW 18 60916651 missense probably benign 0.07
R1538:Arsi UTSW 18 60916651 missense probably benign 0.07
R1635:Arsi UTSW 18 60916651 missense probably benign 0.07
R1759:Arsi UTSW 18 60916651 missense probably benign 0.07
R1794:Arsi UTSW 18 60916651 missense probably benign 0.07
R1822:Arsi UTSW 18 60916651 missense probably benign 0.07
R1824:Arsi UTSW 18 60912297 missense probably damaging 1.00
R1824:Arsi UTSW 18 60916651 missense probably benign 0.07
R1930:Arsi UTSW 18 60916651 missense probably benign 0.07
R1932:Arsi UTSW 18 60916651 missense probably benign 0.07
R1983:Arsi UTSW 18 60916651 missense probably benign 0.07
R2035:Arsi UTSW 18 60916651 missense probably benign 0.07
R2036:Arsi UTSW 18 60916651 missense probably benign 0.07
R2108:Arsi UTSW 18 60916371 missense possibly damaging 0.75
R2166:Arsi UTSW 18 60916651 missense probably benign 0.07
R2168:Arsi UTSW 18 60916651 missense probably benign 0.07
R2261:Arsi UTSW 18 60916665 missense probably damaging 1.00
R2263:Arsi UTSW 18 60916665 missense probably damaging 1.00
R2299:Arsi UTSW 18 60916651 missense probably benign 0.07
R2300:Arsi UTSW 18 60916651 missense probably benign 0.07
R2393:Arsi UTSW 18 60916651 missense probably benign 0.07
R2402:Arsi UTSW 18 60916467 missense possibly damaging 0.88
R2484:Arsi UTSW 18 60916651 missense probably benign 0.07
R2511:Arsi UTSW 18 60916594 missense probably damaging 1.00
R2994:Arsi UTSW 18 60916651 missense probably benign 0.07
R2995:Arsi UTSW 18 60916651 missense probably benign 0.07
R2996:Arsi UTSW 18 60916651 missense probably benign 0.07
R2997:Arsi UTSW 18 60916651 missense probably benign 0.07
R3625:Arsi UTSW 18 60916651 missense probably benign 0.07
R3694:Arsi UTSW 18 60916651 missense probably benign 0.07
R3695:Arsi UTSW 18 60916651 missense probably benign 0.07
R3883:Arsi UTSW 18 60916651 missense probably benign 0.07
R3884:Arsi UTSW 18 60916651 missense probably benign 0.07
R3907:Arsi UTSW 18 60916651 missense probably benign 0.07
R3932:Arsi UTSW 18 60916651 missense probably benign 0.07
R3954:Arsi UTSW 18 60916651 missense probably benign 0.07
R4212:Arsi UTSW 18 60916701 missense probably damaging 1.00
R4256:Arsi UTSW 18 60917316 missense probably damaging 1.00
R4257:Arsi UTSW 18 60916651 missense probably benign 0.07
R4258:Arsi UTSW 18 60917316 missense probably damaging 1.00
R4459:Arsi UTSW 18 60916651 missense probably benign 0.07
R4469:Arsi UTSW 18 60916651 missense probably benign 0.07
R4601:Arsi UTSW 18 60916651 missense probably benign 0.07
R4603:Arsi UTSW 18 60916651 missense probably benign 0.07
R4610:Arsi UTSW 18 60916651 missense probably benign 0.07
R4649:Arsi UTSW 18 60916651 missense probably benign 0.07
R4649:Arsi UTSW 18 60917098 missense probably damaging 1.00
R4650:Arsi UTSW 18 60916651 missense probably benign 0.07
R4651:Arsi UTSW 18 60916651 missense probably benign 0.07
R4652:Arsi UTSW 18 60916651 missense probably benign 0.07
R4749:Arsi UTSW 18 60917461 missense probably benign 0.23
R4766:Arsi UTSW 18 60916651 missense probably benign 0.07
R4807:Arsi UTSW 18 60916651 missense probably benign 0.07
R4808:Arsi UTSW 18 60916651 missense probably benign 0.07
R4856:Arsi UTSW 18 60916651 missense probably benign 0.07
R4860:Arsi UTSW 18 60916651 missense probably benign 0.07
R4860:Arsi UTSW 18 60916651 missense probably benign 0.07
R4886:Arsi UTSW 18 60916651 missense probably benign 0.07
R5015:Arsi UTSW 18 60916651 missense probably benign 0.07
R5121:Arsi UTSW 18 60917439 missense probably damaging 1.00
R5185:Arsi UTSW 18 60916912 missense probably damaging 1.00
R6191:Arsi UTSW 18 60912472 missense probably damaging 1.00
R6197:Arsi UTSW 18 60916651 missense probably benign 0.07
R6218:Arsi UTSW 18 60916651 missense probably benign 0.07
R6219:Arsi UTSW 18 60916651 missense probably benign 0.07
R6220:Arsi UTSW 18 60916651 missense probably benign 0.07
R6378:Arsi UTSW 18 60916501 missense probably damaging 1.00
R6612:Arsi UTSW 18 60912456 missense probably benign 0.12
R6871:Arsi UTSW 18 60916651 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CCAGATCCATACAGGATTGCAGCAC -3'
(R):5'- GTAAGTACCCTTGCGTCCTCGAAG -3'

Sequencing Primer
(F):5'- AGGATTGCAGCACTCCATTATC -3'
(R):5'- AGTTGCTACCCCCTGAGAAG -3'
Posted On2014-04-24