Incidental Mutation 'R1642:2310057J18Rik'
ID173610
Institutional Source Beutler Lab
Gene Symbol 2310057J18Rik
Ensembl Gene ENSMUSG00000015519
Gene NameRIKEN cDNA 2310057J18 gene
Synonyms
MMRRC Submission 039678-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R1642 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location28972288-28986303 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28986237 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 19 (V19A)
Ref Sequence ENSEMBL: ENSMUSP00000015663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015663] [ENSMUST00000140558] [ENSMUST00000152363]
Predicted Effect probably benign
Transcript: ENSMUST00000015663
AA Change: V19A

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000015663
Gene: ENSMUSG00000015519
AA Change: V19A

DomainStartEndE-ValueType
Pfam:DUF781 8 337 4.5e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140558
SMART Domains Protein: ENSMUSP00000121044
Gene: ENSMUSG00000015519

DomainStartEndE-ValueType
Pfam:DUF781 1 228 5.1e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152363
AA Change: V19A

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118049
Gene: ENSMUSG00000015519
AA Change: V19A

DomainStartEndE-ValueType
Pfam:DUF781 1 237 1.9e-116 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215790
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,768,410 probably null Het
4931409K22Rik C A 5: 24,552,688 R177L probably damaging Het
6820408C15Rik T C 2: 152,440,854 Y210H probably damaging Het
Aars T A 8: 111,043,250 I327N possibly damaging Het
Abca6 T A 11: 110,218,281 N688Y possibly damaging Het
Ablim3 T C 18: 61,814,311 K457R probably benign Het
Acsm2 A T 7: 119,563,637 N45Y probably damaging Het
Agxt2 T C 15: 10,373,831 S108P probably damaging Het
Akr1cl A T 1: 65,021,429 M174K probably benign Het
Bfsp1 G A 2: 143,841,763 R214W probably damaging Het
Cby3 A G 11: 50,359,516 D183G probably damaging Het
Clip2 T C 5: 134,503,253 D566G possibly damaging Het
Colgalt1 A G 8: 71,620,757 I341V probably benign Het
Cyp2c38 T A 19: 39,401,709 D349V probably damaging Het
Cyp3a16 T A 5: 145,469,589 I18F unknown Het
Degs2 C T 12: 108,692,192 C176Y probably benign Het
Dhx16 A T 17: 35,891,065 T995S probably damaging Het
Dicer1 A T 12: 104,713,156 C521S probably damaging Het
Dopey2 T C 16: 93,762,315 S532P probably benign Het
Dpysl4 T G 7: 139,090,338 M124R probably damaging Het
Eml6 A G 11: 29,777,001 probably null Het
Erbb4 A T 1: 68,331,234 V395D probably damaging Het
Esf1 T C 2: 140,158,486 D460G possibly damaging Het
F830045P16Rik G A 2: 129,463,714 H247Y probably benign Het
Fsbp T A 4: 11,583,965 S221R probably benign Het
Fstl5 T A 3: 76,410,622 N198K possibly damaging Het
Gemin5 G T 11: 58,139,080 H855Q probably damaging Het
Gjd3 T C 11: 98,982,709 E103G probably benign Het
I0C0044D17Rik A G 4: 98,820,234 probably benign Het
Itgb4 A T 11: 116,007,357 R1646W probably damaging Het
Klri2 A T 6: 129,738,874 C121S probably benign Het
Lamc3 A G 2: 31,915,996 Y703C probably damaging Het
Lrrc10 A G 10: 117,045,883 N154S probably damaging Het
Lrriq1 A G 10: 103,214,456 F812L probably benign Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nav1 T C 1: 135,452,272 Y1564C probably damaging Het
Ndufc1 T C 3: 51,408,243 T25A probably benign Het
Neurl4 A G 11: 69,903,659 M23V probably benign Het
Nnt A G 13: 119,404,550 probably null Het
Nolc1 G C 19: 46,079,022 probably null Het
Nrg1 A T 8: 31,824,508 M289K probably benign Het
Oas3 G T 5: 120,777,574 H17Q possibly damaging Het
Olfr1030 A G 2: 85,983,857 K6E probably benign Het
Olfr239 A G 17: 33,199,456 Y132C probably damaging Het
Olfr30 A G 11: 58,455,838 I37T probably benign Het
Olfr957 C T 9: 39,511,354 R122H possibly damaging Het
Parp9 T C 16: 35,967,697 Y612H probably benign Het
Pcdh1 A T 18: 38,199,230 M240K possibly damaging Het
Pcdhb9 A G 18: 37,400,934 probably benign Het
Plpp2 A G 10: 79,530,684 V42A probably damaging Het
Ppic C T 18: 53,407,062 V172M probably damaging Het
Ppp1r9b A G 11: 95,001,324 silent Het
Prop1 A G 11: 50,953,325 V27A possibly damaging Het
Psmc5 A G 11: 106,262,416 T295A probably benign Het
Rpa1 A G 11: 75,312,691 probably null Het
Rrp12 A G 19: 41,871,737 F1016L probably damaging Het
Scn2a A T 2: 65,683,697 I242F probably damaging Het
Slco1a6 T A 6: 142,086,434 H655L probably benign Het
Sp140 G A 1: 85,610,824 probably null Het
Syne1 A G 10: 5,348,694 I1071T possibly damaging Het
Tbc1d9b A G 11: 50,149,832 D392G probably damaging Het
Tcaim G A 9: 122,818,773 probably null Het
Tgm3 T A 2: 130,047,782 V632E probably damaging Het
Triobp C A 15: 79,002,148 R1830S probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vps8 A G 16: 21,581,579 T1266A probably benign Het
Znfx1 T C 2: 167,039,010 I285V possibly damaging Het
Other mutations in 2310057J18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:2310057J18Rik APN 10 28973958 nonsense probably null
IGL01123:2310057J18Rik APN 10 28973938 missense probably damaging 1.00
IGL01989:2310057J18Rik APN 10 28986270 missense probably damaging 0.99
IGL02268:2310057J18Rik APN 10 28986246 missense probably benign 0.09
R0114:2310057J18Rik UTSW 10 28985982 splice site probably benign
R1585:2310057J18Rik UTSW 10 28982522 missense possibly damaging 0.95
R2271:2310057J18Rik UTSW 10 28981579 missense probably damaging 0.98
R4692:2310057J18Rik UTSW 10 28973886 nonsense probably null
R4801:2310057J18Rik UTSW 10 28983926 critical splice donor site probably null
R4802:2310057J18Rik UTSW 10 28983926 critical splice donor site probably null
R5548:2310057J18Rik UTSW 10 28973867 missense probably benign 0.06
R5677:2310057J18Rik UTSW 10 28986229 missense probably benign 0.00
X0060:2310057J18Rik UTSW 10 28982510 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- ACCTGATTGATACTGCCAGCCAAAC -3'
(R):5'- TGGCATTCTGCCTGGAAAATAGCAC -3'

Sequencing Primer
(F):5'- GCAATCCCCAAAGAAGATTTTGTTC -3'
(R):5'- TCTGCCTGGAAAATAGCACAAATTAC -3'
Posted On2014-04-24