Incidental Mutation 'R1642:Lrriq1'
ID173612
Institutional Source Beutler Lab
Gene Symbol Lrriq1
Ensembl Gene ENSMUSG00000019892
Gene Nameleucine-rich repeats and IQ motif containing 1
SynonymsLOC380658, 4930503E15Rik, Gm1557
MMRRC Submission 039678-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R1642 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location103046031-103236322 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103214456 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 812 (F812L)
Ref Sequence ENSEMBL: ENSMUSP00000020043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020043] [ENSMUST00000123364] [ENSMUST00000166240]
Predicted Effect probably benign
Transcript: ENSMUST00000020043
AA Change: F812L

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000020043
Gene: ENSMUSG00000019892
AA Change: F812L

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 1e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123364
SMART Domains Protein: ENSMUSP00000119783
Gene: ENSMUSG00000019892

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 6e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166240
SMART Domains Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
IQ 290 312 9.78e1 SMART
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
LRR 873 894 2.14e1 SMART
LRR 895 917 4.45e1 SMART
LRR 984 1005 2.03e2 SMART
LRR 1029 1052 3.65e0 SMART
low complexity region 1244 1258 N/A INTRINSIC
IQ 1279 1301 5.61e1 SMART
IQ 1339 1361 6.7e-3 SMART
low complexity region 1369 1394 N/A INTRINSIC
low complexity region 1502 1518 N/A INTRINSIC
low complexity region 1528 1543 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220380
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A G 10: 28,986,237 V19A probably benign Het
3632451O06Rik T C 14: 49,768,410 probably null Het
4931409K22Rik C A 5: 24,552,688 R177L probably damaging Het
6820408C15Rik T C 2: 152,440,854 Y210H probably damaging Het
Aars T A 8: 111,043,250 I327N possibly damaging Het
Abca6 T A 11: 110,218,281 N688Y possibly damaging Het
Ablim3 T C 18: 61,814,311 K457R probably benign Het
Acsm2 A T 7: 119,563,637 N45Y probably damaging Het
Agxt2 T C 15: 10,373,831 S108P probably damaging Het
Akr1cl A T 1: 65,021,429 M174K probably benign Het
Bfsp1 G A 2: 143,841,763 R214W probably damaging Het
Cby3 A G 11: 50,359,516 D183G probably damaging Het
Clip2 T C 5: 134,503,253 D566G possibly damaging Het
Colgalt1 A G 8: 71,620,757 I341V probably benign Het
Cyp2c38 T A 19: 39,401,709 D349V probably damaging Het
Cyp3a16 T A 5: 145,469,589 I18F unknown Het
Degs2 C T 12: 108,692,192 C176Y probably benign Het
Dhx16 A T 17: 35,891,065 T995S probably damaging Het
Dicer1 A T 12: 104,713,156 C521S probably damaging Het
Dopey2 T C 16: 93,762,315 S532P probably benign Het
Dpysl4 T G 7: 139,090,338 M124R probably damaging Het
Eml6 A G 11: 29,777,001 probably null Het
Erbb4 A T 1: 68,331,234 V395D probably damaging Het
Esf1 T C 2: 140,158,486 D460G possibly damaging Het
F830045P16Rik G A 2: 129,463,714 H247Y probably benign Het
Fsbp T A 4: 11,583,965 S221R probably benign Het
Fstl5 T A 3: 76,410,622 N198K possibly damaging Het
Gemin5 G T 11: 58,139,080 H855Q probably damaging Het
Gjd3 T C 11: 98,982,709 E103G probably benign Het
I0C0044D17Rik A G 4: 98,820,234 probably benign Het
Itgb4 A T 11: 116,007,357 R1646W probably damaging Het
Klri2 A T 6: 129,738,874 C121S probably benign Het
Lamc3 A G 2: 31,915,996 Y703C probably damaging Het
Lrrc10 A G 10: 117,045,883 N154S probably damaging Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nav1 T C 1: 135,452,272 Y1564C probably damaging Het
Ndufc1 T C 3: 51,408,243 T25A probably benign Het
Neurl4 A G 11: 69,903,659 M23V probably benign Het
Nnt A G 13: 119,404,550 probably null Het
Nolc1 G C 19: 46,079,022 probably null Het
Nrg1 A T 8: 31,824,508 M289K probably benign Het
Oas3 G T 5: 120,777,574 H17Q possibly damaging Het
Olfr1030 A G 2: 85,983,857 K6E probably benign Het
Olfr239 A G 17: 33,199,456 Y132C probably damaging Het
Olfr30 A G 11: 58,455,838 I37T probably benign Het
Olfr957 C T 9: 39,511,354 R122H possibly damaging Het
Parp9 T C 16: 35,967,697 Y612H probably benign Het
Pcdh1 A T 18: 38,199,230 M240K possibly damaging Het
Pcdhb9 A G 18: 37,400,934 probably benign Het
Plpp2 A G 10: 79,530,684 V42A probably damaging Het
Ppic C T 18: 53,407,062 V172M probably damaging Het
Ppp1r9b A G 11: 95,001,324 silent Het
Prop1 A G 11: 50,953,325 V27A possibly damaging Het
Psmc5 A G 11: 106,262,416 T295A probably benign Het
Rpa1 A G 11: 75,312,691 probably null Het
Rrp12 A G 19: 41,871,737 F1016L probably damaging Het
Scn2a A T 2: 65,683,697 I242F probably damaging Het
Slco1a6 T A 6: 142,086,434 H655L probably benign Het
Sp140 G A 1: 85,610,824 probably null Het
Syne1 A G 10: 5,348,694 I1071T possibly damaging Het
Tbc1d9b A G 11: 50,149,832 D392G probably damaging Het
Tcaim G A 9: 122,818,773 probably null Het
Tgm3 T A 2: 130,047,782 V632E probably damaging Het
Triobp C A 15: 79,002,148 R1830S probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vps8 A G 16: 21,581,579 T1266A probably benign Het
Znfx1 T C 2: 167,039,010 I285V possibly damaging Het
Other mutations in Lrriq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Lrriq1 APN 10 103161896 missense probably damaging 0.99
IGL01523:Lrriq1 APN 10 103218116 nonsense probably null
IGL01637:Lrriq1 APN 10 103215628 missense probably benign
IGL02019:Lrriq1 APN 10 103178800 missense probably benign 0.02
IGL02153:Lrriq1 APN 10 103170479 missense probably benign 0.01
IGL02341:Lrriq1 APN 10 103224941 missense probably benign 0.03
IGL02343:Lrriq1 APN 10 103234163 splice site probably benign
IGL02408:Lrriq1 APN 10 103146281 missense probably benign 0.17
IGL02431:Lrriq1 APN 10 103200639 missense probably damaging 1.00
IGL02540:Lrriq1 APN 10 103215019 missense probably benign 0.02
IGL02558:Lrriq1 APN 10 103146283 missense probably damaging 1.00
IGL02613:Lrriq1 APN 10 103144548 missense probably damaging 0.99
IGL02642:Lrriq1 APN 10 103221461 critical splice acceptor site probably null
IGL03027:Lrriq1 APN 10 103227196 missense probably benign 0.35
PIT4362001:Lrriq1 UTSW 10 103071194 missense probably benign 0.26
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0124:Lrriq1 UTSW 10 103170420 critical splice donor site probably null
R0244:Lrriq1 UTSW 10 103215773 missense probably damaging 0.98
R0323:Lrriq1 UTSW 10 103221289 missense possibly damaging 0.91
R0515:Lrriq1 UTSW 10 103068968 splice site probably null
R0522:Lrriq1 UTSW 10 103161777 missense probably damaging 0.99
R0701:Lrriq1 UTSW 10 103234044 missense probably benign
R1220:Lrriq1 UTSW 10 103071129 missense probably benign 0.05
R1261:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1262:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1451:Lrriq1 UTSW 10 103202515 splice site probably benign
R1643:Lrriq1 UTSW 10 103214824 missense probably benign 0.00
R1647:Lrriq1 UTSW 10 103170648 nonsense probably null
R1830:Lrriq1 UTSW 10 103161759 missense probably benign
R1843:Lrriq1 UTSW 10 103227173 splice site probably null
R2128:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2129:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2199:Lrriq1 UTSW 10 103068913 missense probably damaging 1.00
R2354:Lrriq1 UTSW 10 103189987 missense probably damaging 1.00
R2495:Lrriq1 UTSW 10 103202381 missense probably damaging 0.97
R2897:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2898:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2922:Lrriq1 UTSW 10 103214675 missense probably benign 0.00
R2939:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R2965:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R2966:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R3081:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R3115:Lrriq1 UTSW 10 103170433 missense probably benign 0.00
R3745:Lrriq1 UTSW 10 103170856 missense probably damaging 0.99
R3813:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3814:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3885:Lrriq1 UTSW 10 103216106 missense probably damaging 0.96
R4378:Lrriq1 UTSW 10 103202364 missense probably damaging 1.00
R4632:Lrriq1 UTSW 10 103221427 missense probably damaging 1.00
R4633:Lrriq1 UTSW 10 103200563 nonsense probably null
R4663:Lrriq1 UTSW 10 103063412 missense possibly damaging 0.88
R4702:Lrriq1 UTSW 10 103215749 missense possibly damaging 0.65
R4793:Lrriq1 UTSW 10 103170466 missense probably benign 0.25
R4801:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4802:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4815:Lrriq1 UTSW 10 103144878 missense probably benign 0.10
R4872:Lrriq1 UTSW 10 103178788 missense possibly damaging 0.56
R4877:Lrriq1 UTSW 10 103234038 missense possibly damaging 0.88
R4894:Lrriq1 UTSW 10 103161752 missense possibly damaging 0.86
R4990:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R4991:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R5011:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5013:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5122:Lrriq1 UTSW 10 103187453 missense probably damaging 1.00
R5282:Lrriq1 UTSW 10 103215345 missense probably benign 0.01
R5311:Lrriq1 UTSW 10 103214587 missense probably damaging 1.00
R5567:Lrriq1 UTSW 10 103170596 missense possibly damaging 0.56
R5643:Lrriq1 UTSW 10 103215440 missense probably benign 0.00
R5683:Lrriq1 UTSW 10 103173375 missense probably damaging 1.00
R5916:Lrriq1 UTSW 10 103221382 nonsense probably null
R6008:Lrriq1 UTSW 10 103170464 missense probably damaging 1.00
R6022:Lrriq1 UTSW 10 103215534 missense possibly damaging 0.90
R6224:Lrriq1 UTSW 10 103215757 missense probably damaging 1.00
R6254:Lrriq1 UTSW 10 103215451 missense probably benign 0.15
R6311:Lrriq1 UTSW 10 103173393 missense probably benign 0.03
R6460:Lrriq1 UTSW 10 103200698 missense probably damaging 1.00
R6502:Lrriq1 UTSW 10 103227184 missense probably damaging 0.99
R6637:Lrriq1 UTSW 10 103221432 missense probably benign 0.06
R6719:Lrriq1 UTSW 10 103071116 missense probably damaging 1.00
R6736:Lrriq1 UTSW 10 103181889 critical splice acceptor site probably null
R6928:Lrriq1 UTSW 10 103214939 missense possibly damaging 0.95
R6991:Lrriq1 UTSW 10 103187458 missense probably damaging 1.00
R7174:Lrriq1 UTSW 10 103224965 missense probably benign
R7241:Lrriq1 UTSW 10 103215973 missense probably damaging 1.00
R7248:Lrriq1 UTSW 10 103223750 missense possibly damaging 0.85
R7287:Lrriq1 UTSW 10 103216016 missense probably benign 0.00
X0026:Lrriq1 UTSW 10 103215704 nonsense probably null
Z1088:Lrriq1 UTSW 10 103202446 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACTGCTAAGATGGATAAGGTCCTGG -3'
(R):5'- AGCTGATGGTGTCCTGACTTGCTC -3'

Sequencing Primer
(F):5'- GGTCCTGGTAAACTCTACTTGAGAAC -3'
(R):5'- TTGAGGAAAGGAGACTAGCTTG -3'
Posted On2014-04-24