Incidental Mutation 'R1643:Ank3'
ID173682
Institutional Source Beutler Lab
Gene Symbol Ank3
Ensembl Gene ENSMUSG00000069601
Gene Nameankyrin 3, epithelial
SynonymsAnkyrin-3, Ankyrin-G, AnkG, Ank-3, 2900054D09Rik
MMRRC Submission 039679-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #R1643 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location69398773-70027438 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 69884802 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 565 (S565N)
Ref Sequence ENSEMBL: ENSMUSP00000138348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047061] [ENSMUST00000054167] [ENSMUST00000092431] [ENSMUST00000092432] [ENSMUST00000092434] [ENSMUST00000182155] [ENSMUST00000182439] [ENSMUST00000182884] [ENSMUST00000182992] [ENSMUST00000183148] [ENSMUST00000183169] [ENSMUST00000218680]
Predicted Effect probably benign
Transcript: ENSMUST00000047061
SMART Domains Protein: ENSMUSP00000045834
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ZU5 56 160 2.27e-58 SMART
DEATH 541 635 5.8e-33 SMART
low complexity region 676 696 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000054167
AA Change: S565N
SMART Domains Protein: ENSMUSP00000061698
Gene: ENSMUSG00000069601
AA Change: S565N

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 867 884 N/A INTRINSIC
ZU5 944 1048 2.27e-58 SMART
DEATH 1429 1523 5.8e-33 SMART
low complexity region 1760 1780 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092431
AA Change: S565N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090087
Gene: ENSMUSG00000069601
AA Change: S565N

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 885 902 N/A INTRINSIC
ZU5 962 1066 2.27e-58 SMART
DEATH 1447 1541 5.8e-33 SMART
low complexity region 1778 1798 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092432
AA Change: S565N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090088
Gene: ENSMUSG00000069601
AA Change: S565N

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 888 905 N/A INTRINSIC
ZU5 965 1069 2.27e-58 SMART
DEATH 1450 1544 5.8e-33 SMART
low complexity region 1781 1801 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000092434
AA Change: S565N
SMART Domains Protein: ENSMUSP00000090090
Gene: ENSMUSG00000069601
AA Change: S565N

DomainStartEndE-ValueType
ANK 56 85 6.5e-8 SMART
ANK 89 118 1.1e-8 SMART
ANK 122 151 7.1e-9 SMART
ANK 155 183 4.2e-2 SMART
ANK 184 213 1.7e-1 SMART
ANK 217 246 8.4e-7 SMART
ANK 250 279 3.8e-9 SMART
ANK 283 312 2.1e-6 SMART
ANK 316 345 5.3e-7 SMART
ANK 349 378 9.9e-8 SMART
ANK 382 411 2.5e-9 SMART
ANK 415 444 1.3e-6 SMART
ANK 448 477 6e-8 SMART
ANK 481 510 7.4e-7 SMART
ANK 514 543 1.9e-9 SMART
ANK 547 576 2.2e-8 SMART
ANK 580 609 3e-6 SMART
ANK 613 642 5.4e-8 SMART
ANK 646 675 3.3e-6 SMART
ANK 679 708 4.3e-6 SMART
ANK 712 741 3.9e-8 SMART
ANK 745 774 9.1e-8 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 906 923 N/A INTRINSIC
ZU5 983 1087 1.1e-60 SMART
DEATH 1468 1562 3.8e-35 SMART
low complexity region 1799 1819 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182155
AA Change: S565N
SMART Domains Protein: ENSMUSP00000138347
Gene: ENSMUSG00000069601
AA Change: S565N

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 867 884 N/A INTRINSIC
ZU5 944 1048 2.27e-58 SMART
DEATH 1429 1523 5.8e-33 SMART
low complexity region 1564 1584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182439
SMART Domains Protein: ENSMUSP00000138356
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ZU5 56 160 2.27e-58 SMART
DEATH 541 635 5.8e-33 SMART
low complexity region 676 696 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182474
Predicted Effect unknown
Transcript: ENSMUST00000182884
AA Change: S565N
SMART Domains Protein: ENSMUSP00000138326
Gene: ENSMUSG00000069601
AA Change: S565N

DomainStartEndE-ValueType
ANK 56 85 6.4e-8 SMART
ANK 89 118 1.1e-8 SMART
ANK 122 151 7e-9 SMART
ANK 155 183 4.1e-2 SMART
ANK 184 213 1.7e-1 SMART
ANK 217 246 8.2e-7 SMART
ANK 250 279 3.7e-9 SMART
ANK 283 312 2.1e-6 SMART
ANK 316 345 5.2e-7 SMART
ANK 349 378 9.7e-8 SMART
ANK 382 411 2.4e-9 SMART
ANK 415 444 1.3e-6 SMART
ANK 448 477 5.9e-8 SMART
ANK 481 510 7.3e-7 SMART
ANK 514 543 1.9e-9 SMART
ANK 547 576 2.1e-8 SMART
ANK 580 609 2.9e-6 SMART
ANK 613 642 5.3e-8 SMART
ANK 646 675 3.2e-6 SMART
ANK 679 708 4.2e-6 SMART
ANK 712 741 3.9e-8 SMART
ANK 745 774 8.9e-8 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 906 923 N/A INTRINSIC
ZU5 983 1087 1.1e-60 SMART
DEATH 1468 1562 3.7e-35 SMART
low complexity region 1799 1819 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182992
AA Change: S590N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138686
Gene: ENSMUSG00000069601
AA Change: S590N

DomainStartEndE-ValueType
coiled coil region 4 38 N/A INTRINSIC
ANK 73 102 1.01e-5 SMART
ANK 106 135 1.66e-6 SMART
ANK 139 168 1.1e-6 SMART
ANK 172 200 6.51e0 SMART
ANK 201 230 2.6e1 SMART
ANK 242 271 1.31e-4 SMART
ANK 275 304 5.88e-7 SMART
ANK 308 337 3.23e-4 SMART
ANK 341 370 8.07e-5 SMART
ANK 374 403 1.53e-5 SMART
ANK 407 436 3.88e-7 SMART
ANK 440 469 1.99e-4 SMART
ANK 473 502 9.41e-6 SMART
ANK 506 535 1.14e-4 SMART
ANK 539 568 2.94e-7 SMART
ANK 572 601 3.33e-6 SMART
ANK 605 634 4.56e-4 SMART
ANK 638 667 8.19e-6 SMART
ANK 671 700 5.24e-4 SMART
ANK 704 733 6.46e-4 SMART
ANK 737 766 6.21e-6 SMART
ANK 770 799 1.43e-5 SMART
low complexity region 827 838 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
ZU5 990 1094 2.27e-58 SMART
low complexity region 1515 1536 N/A INTRINSIC
low complexity region 1745 1762 N/A INTRINSIC
low complexity region 1805 1827 N/A INTRINSIC
low complexity region 1876 1897 N/A INTRINSIC
low complexity region 1969 1984 N/A INTRINSIC
DEATH 2325 2419 7.66e-33 SMART
low complexity region 2460 2480 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183148
AA Change: S565N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000138770
Gene: ENSMUSG00000069601
AA Change: S565N

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
ZU5 943 1047 2.27e-58 SMART
DEATH 1416 1510 7.66e-33 SMART
low complexity region 1747 1767 N/A INTRINSIC
low complexity region 1893 1902 N/A INTRINSIC
low complexity region 1904 1916 N/A INTRINSIC
low complexity region 1942 1954 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183169
AA Change: S565N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000138348
Gene: ENSMUSG00000069601
AA Change: S565N

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
ZU5 943 1047 2.27e-58 SMART
DEATH 1416 1510 7.66e-33 SMART
low complexity region 1551 1571 N/A INTRINSIC
low complexity region 1715 1724 N/A INTRINSIC
low complexity region 1726 1738 N/A INTRINSIC
low complexity region 1764 1776 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218680
AA Change: S576N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1036 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.5%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: This gene encodes a member of the ankyrin protein family. Ankyrins link integral membrane proteins to the spectrin-based cytoskeleton. Ankyrin family members share a protein structure which includes three independently folded domains: the N-terminal ankyrin repeat domain, the central spectrin-binding domain, and the C-terminal rod domain. This ankyrin functions as the major ankyrin in the kidney and may play a role in the polarized distribution of many integral membrane proteins to specific subcellular sites. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a mutation that selectively ablates gene expression in brain exhibit progressive ataxia, tremors, and a substantially reduced cerebellum deficient in Purkinje cells. Mutants are poor breeders and die by 4-6 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik T A 16: 3,907,078 K45* probably null Het
Abcc1 T A 16: 14,413,368 Y457N probably damaging Het
Actr3b A G 5: 25,812,011 D19G probably damaging Het
Adam39 T C 8: 40,826,486 V638A possibly damaging Het
Adamts1 G T 16: 85,796,817 probably benign Het
AI661453 A G 17: 47,467,866 probably benign Het
Casd1 A G 6: 4,621,243 E267G probably benign Het
Casr T C 16: 36,500,205 K527R probably damaging Het
Cep128 A C 12: 91,325,532 S248A probably damaging Het
Clic4 A G 4: 135,238,895 V50A possibly damaging Het
Cylc2 C T 4: 51,225,173 A36V probably benign Het
Derl1 T A 15: 57,878,559 M127L probably benign Het
Dnah6 A G 6: 73,044,752 V3529A possibly damaging Het
Dock1 G T 7: 135,098,779 L1089F probably damaging Het
Edil3 T A 13: 89,289,576 probably null Het
Ephb1 A G 9: 101,996,825 V550A probably damaging Het
Fam129c A G 8: 71,600,164 D94G probably benign Het
Fcho2 G A 13: 98,784,816 T187I probably benign Het
Gas6 T C 8: 13,465,902 probably null Het
Gdf7 T C 12: 8,297,971 Y442C probably damaging Het
Gm11567 G A 11: 99,879,797 G187E unknown Het
Gm11639 A T 11: 104,698,978 T134S probably benign Het
Gm8674 T C 13: 49,901,358 noncoding transcript Het
Ift80 T A 3: 68,916,157 I591F probably benign Het
Kcnn3 C T 3: 89,520,497 S10L unknown Het
Keg1 A G 19: 12,719,042 I197V probably benign Het
Klhdc9 A G 1: 171,359,466 probably null Het
Klhl11 A G 11: 100,463,015 V660A probably benign Het
Lamc1 T C 1: 153,258,072 probably benign Het
Lrrc73 G T 17: 46,255,340 probably null Het
Lrriq1 G A 10: 103,214,824 S689L probably benign Het
Magi2 A G 5: 20,705,506 probably benign Het
Meis1 A G 11: 19,016,278 S32P probably benign Het
Mia2 A G 12: 59,179,845 probably null Het
Mlph T C 1: 90,941,734 L486P probably damaging Het
Myh10 A G 11: 68,792,010 E1090G probably damaging Het
Mylk T C 16: 34,875,635 S247P probably benign Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Ndufc1 T C 3: 51,408,243 T25A probably benign Het
Nedd4l A G 18: 65,198,641 Y636C probably damaging Het
Nfib A T 4: 82,498,679 Y40N probably damaging Het
Nisch T C 14: 31,173,168 D1057G probably damaging Het
P3h2 T C 16: 25,972,291 H475R probably benign Het
Pde6c C A 19: 38,161,958 T517K possibly damaging Het
Piezo2 T C 18: 63,082,915 I994V probably benign Het
Pik3r4 A G 9: 105,687,152 D1315G possibly damaging Het
Pip5k1c T G 10: 81,314,994 V46G probably damaging Het
Pole A G 5: 110,317,845 E1213G probably damaging Het
Prl7d1 T C 13: 27,712,131 S88G possibly damaging Het
Prodh T A 16: 18,081,069 N72I probably benign Het
Prrc2a G A 17: 35,156,954 R907C probably damaging Het
Ptger2 T A 14: 44,988,966 M1K probably null Het
Samd4b G C 7: 28,423,616 Q6E probably damaging Het
Sec24a C T 11: 51,704,385 R916H probably benign Het
Slc12a5 C A 2: 164,994,027 D865E probably benign Het
Slc17a3 T C 13: 23,857,198 probably benign Het
Ssrp1 T C 2: 85,041,185 V317A possibly damaging Het
Stim1 A G 7: 102,386,100 D95G possibly damaging Het
Taok2 A T 7: 126,875,938 probably benign Het
Tcof1 T G 18: 60,816,228 K1205T possibly damaging Het
Trim43c C T 9: 88,847,477 R325C probably damaging Het
Trub2 T G 2: 29,777,936 T231P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uty T A Y: 1,152,054 D724V probably damaging Het
Vmn2r98 A G 17: 19,080,908 D724G probably damaging Het
Wdfy3 A G 5: 101,875,915 I2442T possibly damaging Het
Wdfy4 T C 14: 33,073,585 probably null Het
Zfp280b A G 10: 76,039,610 H441R probably damaging Het
Zfp60 A T 7: 27,736,975 Q7L probably damaging Het
Zzef1 T C 11: 72,826,202 L406S probably damaging Het
Other mutations in Ank3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Ank3 APN 10 69982205 splice site probably benign
IGL00578:Ank3 APN 10 70002394 missense possibly damaging 0.95
IGL00851:Ank3 APN 10 69874833 missense probably damaging 0.99
IGL01067:Ank3 APN 10 69850196 missense probably damaging 1.00
IGL01483:Ank3 APN 10 69874809 missense probably damaging 1.00
IGL01549:Ank3 APN 10 69932420 missense probably damaging 1.00
IGL01576:Ank3 APN 10 69980291 missense probably damaging 1.00
IGL01601:Ank3 APN 10 70004725 missense possibly damaging 0.87
IGL02047:Ank3 APN 10 69892494 missense possibly damaging 0.94
IGL02088:Ank3 APN 10 69999373 missense probably damaging 1.00
IGL02159:Ank3 APN 10 69808892 missense probably damaging 1.00
IGL02249:Ank3 APN 10 69882370 missense probably damaging 1.00
IGL02942:Ank3 APN 10 69973877 missense probably damaging 1.00
IGL02979:Ank3 APN 10 70002099 missense probably benign 0.01
IGL03379:Ank3 APN 10 69973772 missense probably damaging 1.00
PIT4495001:Ank3 UTSW 10 69993072 missense
R0011:Ank3 UTSW 10 69979451 splice site probably benign
R0011:Ank3 UTSW 10 69979451 splice site probably benign
R0172:Ank3 UTSW 10 69976058 missense probably damaging 1.00
R0315:Ank3 UTSW 10 70002517 missense probably damaging 0.98
R0480:Ank3 UTSW 10 69879926 missense probably damaging 0.96
R0485:Ank3 UTSW 10 69882544 missense possibly damaging 0.89
R0511:Ank3 UTSW 10 69882368 missense probably damaging 1.00
R1148:Ank3 UTSW 10 69882539 missense probably damaging 1.00
R1148:Ank3 UTSW 10 69882539 missense probably damaging 1.00
R1165:Ank3 UTSW 10 69898302 missense possibly damaging 0.90
R1186:Ank3 UTSW 10 69867460 missense probably damaging 1.00
R1257:Ank3 UTSW 10 69874835 nonsense probably null
R1300:Ank3 UTSW 10 70004665 missense probably benign 0.03
R1391:Ank3 UTSW 10 69534280 missense possibly damaging 0.96
R1549:Ank3 UTSW 10 70001982 missense probably benign 0.18
R1586:Ank3 UTSW 10 69877878 missense probably damaging 0.98
R1619:Ank3 UTSW 10 69879975 missense probably damaging 1.00
R1874:Ank3 UTSW 10 69898083 missense probably damaging 1.00
R1884:Ank3 UTSW 10 70015592 missense possibly damaging 0.53
R1901:Ank3 UTSW 10 69822337 missense probably damaging 1.00
R1986:Ank3 UTSW 10 69867428 missense probably damaging 1.00
R2051:Ank3 UTSW 10 69898090 missense probably damaging 0.97
R2273:Ank3 UTSW 10 69950942 splice site probably null
R2274:Ank3 UTSW 10 69950942 splice site probably null
R2421:Ank3 UTSW 10 69982204 splice site probably benign
R2434:Ank3 UTSW 10 70002118 missense probably damaging 1.00
R2969:Ank3 UTSW 10 69994395 missense probably damaging 1.00
R3426:Ank3 UTSW 10 69706894 missense probably benign
R3885:Ank3 UTSW 10 69899036 missense probably damaging 1.00
R3936:Ank3 UTSW 10 69879989 nonsense probably null
R4258:Ank3 UTSW 10 70004762 missense probably benign 0.33
R4320:Ank3 UTSW 10 69904246 missense possibly damaging 0.70
R4434:Ank3 UTSW 10 69987070 missense probably damaging 0.99
R4435:Ank3 UTSW 10 69987070 missense probably damaging 0.99
R4486:Ank3 UTSW 10 70001974 missense possibly damaging 0.86
R4489:Ank3 UTSW 10 69898256 missense probably damaging 1.00
R4492:Ank3 UTSW 10 69808925 missense probably damaging 1.00
R4508:Ank3 UTSW 10 69892370 missense probably damaging 1.00
R4561:Ank3 UTSW 10 70002018 missense probably damaging 0.99
R4724:Ank3 UTSW 10 69706858 missense probably benign
R4751:Ank3 UTSW 10 69986206 missense probably benign 0.19
R4790:Ank3 UTSW 10 69988151 nonsense probably null
R4795:Ank3 UTSW 10 69858265 missense probably benign 0.36
R4921:Ank3 UTSW 10 70002109 missense probably damaging 1.00
R4932:Ank3 UTSW 10 69898223 splice site probably null
R4935:Ank3 UTSW 10 69976203 missense probably damaging 0.99
R4946:Ank3 UTSW 10 69898117 missense probably damaging 1.00
R5174:Ank3 UTSW 10 69892379 missense probably damaging 0.99
R5208:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5248:Ank3 UTSW 10 69987108 missense probably benign 0.00
R5255:Ank3 UTSW 10 69885200 missense probably damaging 1.00
R5307:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5308:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5373:Ank3 UTSW 10 69953476 splice site probably null
R5374:Ank3 UTSW 10 69953476 splice site probably null
R5502:Ank3 UTSW 10 69920461 missense probably benign 0.12
R5508:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5509:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5510:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5538:Ank3 UTSW 10 69987427 missense probably damaging 1.00
R5664:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5665:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5682:Ank3 UTSW 10 69893517 missense probably damaging 1.00
R5834:Ank3 UTSW 10 69822257 missense probably damaging 1.00
R5881:Ank3 UTSW 10 69986830 missense probably benign 0.31
R5914:Ank3 UTSW 10 69992944 intron probably benign
R5940:Ank3 UTSW 10 69920486 missense probably benign 0.00
R5952:Ank3 UTSW 10 69986463 missense probably benign 0.07
R5963:Ank3 UTSW 10 69987226 nonsense probably null
R6075:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6076:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6077:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6081:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6092:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6118:Ank3 UTSW 10 69994401 missense probably damaging 0.98
R6135:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6175:Ank3 UTSW 10 69927727 missense probably damaging 1.00
R6248:Ank3 UTSW 10 69973850 missense probably benign 0.10
R6249:Ank3 UTSW 10 69823076 critical splice acceptor site probably null
R6273:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6274:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6290:Ank3 UTSW 10 69991368 intron probably benign
R6298:Ank3 UTSW 10 69850176 missense probably damaging 1.00
R6349:Ank3 UTSW 10 69979439 missense probably damaging 1.00
R6366:Ank3 UTSW 10 69999358 missense probably damaging 1.00
R6371:Ank3 UTSW 10 69808879 missense probably damaging 1.00
R6459:Ank3 UTSW 10 69991747 intron probably benign
R6489:Ank3 UTSW 10 69991629 missense probably benign 0.00
R6491:Ank3 UTSW 10 69991629 missense probably benign 0.00
R6499:Ank3 UTSW 10 69991744 intron probably benign
R6520:Ank3 UTSW 10 69988387 missense probably damaging 1.00
R6521:Ank3 UTSW 10 69992766 intron probably benign
R6535:Ank3 UTSW 10 69877854 missense probably damaging 1.00
R6548:Ank3 UTSW 10 69892410 missense probably damaging 1.00
R6587:Ank3 UTSW 10 69990152 intron probably benign
R6624:Ank3 UTSW 10 69904468 missense possibly damaging 0.66
R6722:Ank3 UTSW 10 69990244 intron probably benign
R6729:Ank3 UTSW 10 69808925 missense probably damaging 1.00
R6731:Ank3 UTSW 10 70014028 missense possibly damaging 0.70
R6742:Ank3 UTSW 10 69991582 intron probably benign
R6788:Ank3 UTSW 10 70004723 missense probably damaging 1.00
R6846:Ank3 UTSW 10 69824349 missense probably damaging 1.00
R6933:Ank3 UTSW 10 69904212 missense probably damaging 1.00
R7034:Ank3 UTSW 10 69999379 missense probably damaging 1.00
R7036:Ank3 UTSW 10 69999379 missense probably damaging 1.00
R7132:Ank3 UTSW 10 69989914 missense
Predicted Primers PCR Primer
(F):5'- AGCTACCGTGAGACACCTATGACC -3'
(R):5'- TGTGAGCCAGCATTCACCTGATCC -3'

Sequencing Primer
(F):5'- CCCTTAAGACTAGAGAAGTCTTCAG -3'
(R):5'- AGTCTTTACCCTAGTGAGACTTCAG -3'
Posted On2014-04-24