Incidental Mutation 'R1643:Lrriq1'
ID173686
Institutional Source Beutler Lab
Gene Symbol Lrriq1
Ensembl Gene ENSMUSG00000019892
Gene Nameleucine-rich repeats and IQ motif containing 1
SynonymsLOC380658, 4930503E15Rik, Gm1557
MMRRC Submission 039679-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R1643 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location103046031-103236322 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 103214824 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 689 (S689L)
Ref Sequence ENSEMBL: ENSMUSP00000131419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020043] [ENSMUST00000123364] [ENSMUST00000166240]
Predicted Effect probably benign
Transcript: ENSMUST00000020043
AA Change: S689L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000020043
Gene: ENSMUSG00000019892
AA Change: S689L

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 1e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123364
SMART Domains Protein: ENSMUSP00000119783
Gene: ENSMUSG00000019892

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 6e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166240
AA Change: S689L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: S689L

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
IQ 290 312 9.78e1 SMART
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
LRR 873 894 2.14e1 SMART
LRR 895 917 4.45e1 SMART
LRR 984 1005 2.03e2 SMART
LRR 1029 1052 3.65e0 SMART
low complexity region 1244 1258 N/A INTRINSIC
IQ 1279 1301 5.61e1 SMART
IQ 1339 1361 6.7e-3 SMART
low complexity region 1369 1394 N/A INTRINSIC
low complexity region 1502 1518 N/A INTRINSIC
low complexity region 1528 1543 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220380
Meta Mutation Damage Score 0.1164 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.5%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik T A 16: 3,907,078 K45* probably null Het
Abcc1 T A 16: 14,413,368 Y457N probably damaging Het
Actr3b A G 5: 25,812,011 D19G probably damaging Het
Adam39 T C 8: 40,826,486 V638A possibly damaging Het
Adamts1 G T 16: 85,796,817 probably benign Het
AI661453 A G 17: 47,467,866 probably benign Het
Ank3 G A 10: 69,884,802 S565N probably benign Het
Casd1 A G 6: 4,621,243 E267G probably benign Het
Casr T C 16: 36,500,205 K527R probably damaging Het
Cep128 A C 12: 91,325,532 S248A probably damaging Het
Clic4 A G 4: 135,238,895 V50A possibly damaging Het
Cylc2 C T 4: 51,225,173 A36V probably benign Het
Derl1 T A 15: 57,878,559 M127L probably benign Het
Dnah6 A G 6: 73,044,752 V3529A possibly damaging Het
Dock1 G T 7: 135,098,779 L1089F probably damaging Het
Edil3 T A 13: 89,289,576 probably null Het
Ephb1 A G 9: 101,996,825 V550A probably damaging Het
Fam129c A G 8: 71,600,164 D94G probably benign Het
Fcho2 G A 13: 98,784,816 T187I probably benign Het
Gas6 T C 8: 13,465,902 probably null Het
Gdf7 T C 12: 8,297,971 Y442C probably damaging Het
Gm11567 G A 11: 99,879,797 G187E unknown Het
Gm11639 A T 11: 104,698,978 T134S probably benign Het
Gm8674 T C 13: 49,901,358 noncoding transcript Het
Ift80 T A 3: 68,916,157 I591F probably benign Het
Kcnn3 C T 3: 89,520,497 S10L unknown Het
Keg1 A G 19: 12,719,042 I197V probably benign Het
Klhdc9 A G 1: 171,359,466 probably null Het
Klhl11 A G 11: 100,463,015 V660A probably benign Het
Lamc1 T C 1: 153,258,072 probably benign Het
Lrrc73 G T 17: 46,255,340 probably null Het
Magi2 A G 5: 20,705,506 probably benign Het
Meis1 A G 11: 19,016,278 S32P probably benign Het
Mia2 A G 12: 59,179,845 probably null Het
Mlph T C 1: 90,941,734 L486P probably damaging Het
Myh10 A G 11: 68,792,010 E1090G probably damaging Het
Mylk T C 16: 34,875,635 S247P probably benign Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Ndufc1 T C 3: 51,408,243 T25A probably benign Het
Nedd4l A G 18: 65,198,641 Y636C probably damaging Het
Nfib A T 4: 82,498,679 Y40N probably damaging Het
Nisch T C 14: 31,173,168 D1057G probably damaging Het
P3h2 T C 16: 25,972,291 H475R probably benign Het
Pde6c C A 19: 38,161,958 T517K possibly damaging Het
Piezo2 T C 18: 63,082,915 I994V probably benign Het
Pik3r4 A G 9: 105,687,152 D1315G possibly damaging Het
Pip5k1c T G 10: 81,314,994 V46G probably damaging Het
Pole A G 5: 110,317,845 E1213G probably damaging Het
Prl7d1 T C 13: 27,712,131 S88G possibly damaging Het
Prodh T A 16: 18,081,069 N72I probably benign Het
Prrc2a G A 17: 35,156,954 R907C probably damaging Het
Ptger2 T A 14: 44,988,966 M1K probably null Het
Samd4b G C 7: 28,423,616 Q6E probably damaging Het
Sec24a C T 11: 51,704,385 R916H probably benign Het
Slc12a5 C A 2: 164,994,027 D865E probably benign Het
Slc17a3 T C 13: 23,857,198 probably benign Het
Ssrp1 T C 2: 85,041,185 V317A possibly damaging Het
Stim1 A G 7: 102,386,100 D95G possibly damaging Het
Taok2 A T 7: 126,875,938 probably benign Het
Tcof1 T G 18: 60,816,228 K1205T possibly damaging Het
Trim43c C T 9: 88,847,477 R325C probably damaging Het
Trub2 T G 2: 29,777,936 T231P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uty T A Y: 1,152,054 D724V probably damaging Het
Vmn2r98 A G 17: 19,080,908 D724G probably damaging Het
Wdfy3 A G 5: 101,875,915 I2442T possibly damaging Het
Wdfy4 T C 14: 33,073,585 probably null Het
Zfp280b A G 10: 76,039,610 H441R probably damaging Het
Zfp60 A T 7: 27,736,975 Q7L probably damaging Het
Zzef1 T C 11: 72,826,202 L406S probably damaging Het
Other mutations in Lrriq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Lrriq1 APN 10 103161896 missense probably damaging 0.99
IGL01523:Lrriq1 APN 10 103218116 nonsense probably null
IGL01637:Lrriq1 APN 10 103215628 missense probably benign
IGL02019:Lrriq1 APN 10 103178800 missense probably benign 0.02
IGL02153:Lrriq1 APN 10 103170479 missense probably benign 0.01
IGL02341:Lrriq1 APN 10 103224941 missense probably benign 0.03
IGL02343:Lrriq1 APN 10 103234163 splice site probably benign
IGL02408:Lrriq1 APN 10 103146281 missense probably benign 0.17
IGL02431:Lrriq1 APN 10 103200639 missense probably damaging 1.00
IGL02540:Lrriq1 APN 10 103215019 missense probably benign 0.02
IGL02558:Lrriq1 APN 10 103146283 missense probably damaging 1.00
IGL02613:Lrriq1 APN 10 103144548 missense probably damaging 0.99
IGL02642:Lrriq1 APN 10 103221461 critical splice acceptor site probably null
IGL03027:Lrriq1 APN 10 103227196 missense probably benign 0.35
PIT4362001:Lrriq1 UTSW 10 103071194 missense probably benign 0.26
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0124:Lrriq1 UTSW 10 103170420 critical splice donor site probably null
R0244:Lrriq1 UTSW 10 103215773 missense probably damaging 0.98
R0323:Lrriq1 UTSW 10 103221289 missense possibly damaging 0.91
R0515:Lrriq1 UTSW 10 103068968 splice site probably null
R0522:Lrriq1 UTSW 10 103161777 missense probably damaging 0.99
R0701:Lrriq1 UTSW 10 103234044 missense probably benign
R1220:Lrriq1 UTSW 10 103071129 missense probably benign 0.05
R1261:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1262:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1451:Lrriq1 UTSW 10 103202515 splice site probably benign
R1642:Lrriq1 UTSW 10 103214456 missense probably benign 0.13
R1647:Lrriq1 UTSW 10 103170648 nonsense probably null
R1830:Lrriq1 UTSW 10 103161759 missense probably benign
R1843:Lrriq1 UTSW 10 103227173 splice site probably null
R2128:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2129:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2199:Lrriq1 UTSW 10 103068913 missense probably damaging 1.00
R2354:Lrriq1 UTSW 10 103189987 missense probably damaging 1.00
R2495:Lrriq1 UTSW 10 103202381 missense probably damaging 0.97
R2897:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2898:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2922:Lrriq1 UTSW 10 103214675 missense probably benign 0.00
R2939:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R2965:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R2966:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R3081:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R3115:Lrriq1 UTSW 10 103170433 missense probably benign 0.00
R3745:Lrriq1 UTSW 10 103170856 missense probably damaging 0.99
R3813:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3814:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3885:Lrriq1 UTSW 10 103216106 missense probably damaging 0.96
R4378:Lrriq1 UTSW 10 103202364 missense probably damaging 1.00
R4632:Lrriq1 UTSW 10 103221427 missense probably damaging 1.00
R4633:Lrriq1 UTSW 10 103200563 nonsense probably null
R4663:Lrriq1 UTSW 10 103063412 missense possibly damaging 0.88
R4702:Lrriq1 UTSW 10 103215749 missense possibly damaging 0.65
R4793:Lrriq1 UTSW 10 103170466 missense probably benign 0.25
R4801:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4802:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4815:Lrriq1 UTSW 10 103144878 missense probably benign 0.10
R4872:Lrriq1 UTSW 10 103178788 missense possibly damaging 0.56
R4877:Lrriq1 UTSW 10 103234038 missense possibly damaging 0.88
R4894:Lrriq1 UTSW 10 103161752 missense possibly damaging 0.86
R4990:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R4991:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R5011:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5013:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5122:Lrriq1 UTSW 10 103187453 missense probably damaging 1.00
R5282:Lrriq1 UTSW 10 103215345 missense probably benign 0.01
R5311:Lrriq1 UTSW 10 103214587 missense probably damaging 1.00
R5567:Lrriq1 UTSW 10 103170596 missense possibly damaging 0.56
R5643:Lrriq1 UTSW 10 103215440 missense probably benign 0.00
R5683:Lrriq1 UTSW 10 103173375 missense probably damaging 1.00
R5916:Lrriq1 UTSW 10 103221382 nonsense probably null
R6008:Lrriq1 UTSW 10 103170464 missense probably damaging 1.00
R6022:Lrriq1 UTSW 10 103215534 missense possibly damaging 0.90
R6224:Lrriq1 UTSW 10 103215757 missense probably damaging 1.00
R6254:Lrriq1 UTSW 10 103215451 missense probably benign 0.15
R6311:Lrriq1 UTSW 10 103173393 missense probably benign 0.03
R6460:Lrriq1 UTSW 10 103200698 missense probably damaging 1.00
R6502:Lrriq1 UTSW 10 103227184 missense probably damaging 0.99
R6637:Lrriq1 UTSW 10 103221432 missense probably benign 0.06
R6719:Lrriq1 UTSW 10 103071116 missense probably damaging 1.00
R6736:Lrriq1 UTSW 10 103181889 critical splice acceptor site probably null
R6928:Lrriq1 UTSW 10 103214939 missense possibly damaging 0.95
R6991:Lrriq1 UTSW 10 103187458 missense probably damaging 1.00
R7174:Lrriq1 UTSW 10 103224965 missense probably benign
R7241:Lrriq1 UTSW 10 103215973 missense probably damaging 1.00
R7248:Lrriq1 UTSW 10 103223750 missense possibly damaging 0.85
R7287:Lrriq1 UTSW 10 103216016 missense probably benign 0.00
X0026:Lrriq1 UTSW 10 103215704 nonsense probably null
Z1088:Lrriq1 UTSW 10 103202446 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACACCATCAGCTTCAGCCTTTG -3'
(R):5'- TGAATGAACAGTACCCGTGGCAAG -3'

Sequencing Primer
(F):5'- GTCTGCTGTCCTTTTTCCAGAG -3'
(R):5'- TCGGATGAGAATAATAGCTCACC -3'
Posted On2014-04-24