Incidental Mutation 'R1643:Vmn2r98'
ID173715
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Namevomeronasal 2, receptor 98
SynonymsEG224552
MMRRC Submission 039679-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R1643 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location19053460-19082411 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19080908 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 724 (D724G)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
Predicted Effect probably damaging
Transcript: ENSMUST00000170424
AA Change: D724G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: D724G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Meta Mutation Damage Score 0.1564 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.5%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik T A 16: 3,907,078 K45* probably null Het
Abcc1 T A 16: 14,413,368 Y457N probably damaging Het
Actr3b A G 5: 25,812,011 D19G probably damaging Het
Adam39 T C 8: 40,826,486 V638A possibly damaging Het
Adamts1 G T 16: 85,796,817 probably benign Het
AI661453 A G 17: 47,467,866 probably benign Het
Ank3 G A 10: 69,884,802 S565N probably benign Het
Casd1 A G 6: 4,621,243 E267G probably benign Het
Casr T C 16: 36,500,205 K527R probably damaging Het
Cep128 A C 12: 91,325,532 S248A probably damaging Het
Clic4 A G 4: 135,238,895 V50A possibly damaging Het
Cylc2 C T 4: 51,225,173 A36V probably benign Het
Derl1 T A 15: 57,878,559 M127L probably benign Het
Dnah6 A G 6: 73,044,752 V3529A possibly damaging Het
Dock1 G T 7: 135,098,779 L1089F probably damaging Het
Edil3 T A 13: 89,289,576 probably null Het
Ephb1 A G 9: 101,996,825 V550A probably damaging Het
Fam129c A G 8: 71,600,164 D94G probably benign Het
Fcho2 G A 13: 98,784,816 T187I probably benign Het
Gas6 T C 8: 13,465,902 probably null Het
Gdf7 T C 12: 8,297,971 Y442C probably damaging Het
Gm11567 G A 11: 99,879,797 G187E unknown Het
Gm11639 A T 11: 104,698,978 T134S probably benign Het
Gm8674 T C 13: 49,901,358 noncoding transcript Het
Ift80 T A 3: 68,916,157 I591F probably benign Het
Kcnn3 C T 3: 89,520,497 S10L unknown Het
Keg1 A G 19: 12,719,042 I197V probably benign Het
Klhdc9 A G 1: 171,359,466 probably null Het
Klhl11 A G 11: 100,463,015 V660A probably benign Het
Lamc1 T C 1: 153,258,072 probably benign Het
Lrrc73 G T 17: 46,255,340 probably null Het
Lrriq1 G A 10: 103,214,824 S689L probably benign Het
Magi2 A G 5: 20,705,506 probably benign Het
Meis1 A G 11: 19,016,278 S32P probably benign Het
Mia2 A G 12: 59,179,845 probably null Het
Mlph T C 1: 90,941,734 L486P probably damaging Het
Myh10 A G 11: 68,792,010 E1090G probably damaging Het
Mylk T C 16: 34,875,635 S247P probably benign Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Ndufc1 T C 3: 51,408,243 T25A probably benign Het
Nedd4l A G 18: 65,198,641 Y636C probably damaging Het
Nfib A T 4: 82,498,679 Y40N probably damaging Het
Nisch T C 14: 31,173,168 D1057G probably damaging Het
P3h2 T C 16: 25,972,291 H475R probably benign Het
Pde6c C A 19: 38,161,958 T517K possibly damaging Het
Piezo2 T C 18: 63,082,915 I994V probably benign Het
Pik3r4 A G 9: 105,687,152 D1315G possibly damaging Het
Pip5k1c T G 10: 81,314,994 V46G probably damaging Het
Pole A G 5: 110,317,845 E1213G probably damaging Het
Prl7d1 T C 13: 27,712,131 S88G possibly damaging Het
Prodh T A 16: 18,081,069 N72I probably benign Het
Prrc2a G A 17: 35,156,954 R907C probably damaging Het
Ptger2 T A 14: 44,988,966 M1K probably null Het
Samd4b G C 7: 28,423,616 Q6E probably damaging Het
Sec24a C T 11: 51,704,385 R916H probably benign Het
Slc12a5 C A 2: 164,994,027 D865E probably benign Het
Slc17a3 T C 13: 23,857,198 probably benign Het
Ssrp1 T C 2: 85,041,185 V317A possibly damaging Het
Stim1 A G 7: 102,386,100 D95G possibly damaging Het
Taok2 A T 7: 126,875,938 probably benign Het
Tcof1 T G 18: 60,816,228 K1205T possibly damaging Het
Trim43c C T 9: 88,847,477 R325C probably damaging Het
Trub2 T G 2: 29,777,936 T231P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uty T A Y: 1,152,054 D724V probably damaging Het
Wdfy3 A G 5: 101,875,915 I2442T possibly damaging Het
Wdfy4 T C 14: 33,073,585 probably null Het
Zfp280b A G 10: 76,039,610 H441R probably damaging Het
Zfp60 A T 7: 27,736,975 Q7L probably damaging Het
Zzef1 T C 11: 72,826,202 L406S probably damaging Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19065745 splice site probably benign
IGL01296:Vmn2r98 APN 17 19065185 missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19065758 missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19065259 missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19066451 missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19066286 missense probably benign
IGL02123:Vmn2r98 APN 17 19080679 missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19065851 missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19065821 missense probably benign
IGL02650:Vmn2r98 APN 17 19080961 missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19065259 missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19066013 missense probably benign
IGL02807:Vmn2r98 APN 17 19081021 missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19065980 missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19069845 missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19080961 missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19066400 missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19065827 nonsense probably null
R0545:Vmn2r98 UTSW 17 19053613 missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19080497 missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19080520 missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19080749 missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19065948 missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19065178 missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R1795:Vmn2r98 UTSW 17 19066440 missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19066418 missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19065333 nonsense probably null
R2165:Vmn2r98 UTSW 17 19081291 missense unknown
R2238:Vmn2r98 UTSW 17 19065951 missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19080436 missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19065819 missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19081177 missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19067402 missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19080625 missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19066092 missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19069745 missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19066340 missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19066157 missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19066044 missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19053553 missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19080719 missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19069754 nonsense probably null
R5371:Vmn2r98 UTSW 17 19069753 missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19080899 missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19065998 missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19066074 missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19065881 missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19065801 missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19065248 missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19066268 missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19080922 missense probably benign
R7068:Vmn2r98 UTSW 17 19065313 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAAAGCTATCACTGTGGTCCTTGC -3'
(R):5'- TGCTGTGCTGGAAGCCAAGATG -3'

Sequencing Primer
(F):5'- GCCTTTAAGATCAGTTTTCCAGG -3'
(R):5'- GAAGAACACCAGCATACTGAATG -3'
Posted On2014-04-24