Incidental Mutation 'R1644:Sema4c'
ID173729
Institutional Source Beutler Lab
Gene Symbol Sema4c
Ensembl Gene ENSMUSG00000026121
Gene Namesema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C
SynonymsSemaf, Semacl1, M-Sema F, Semacl1, Semai
MMRRC Submission 039680-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1644 (G1)
Quality Score200
Status Validated
Chromosome1
Chromosomal Location36548639-36558349 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36550804 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 490 (S490P)
Ref Sequence ENSEMBL: ENSMUSP00000141527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001172] [ENSMUST00000114991] [ENSMUST00000191642] [ENSMUST00000191677] [ENSMUST00000193382] [ENSMUST00000194894] [ENSMUST00000195620] [ENSMUST00000207843]
Predicted Effect probably benign
Transcript: ENSMUST00000001172
SMART Domains Protein: ENSMUSP00000001172
Gene: ENSMUSG00000079610

DomainStartEndE-ValueType
ANK 30 59 8.77e2 SMART
ANK 63 92 1.08e-5 SMART
ANK 96 127 1.27e-2 SMART
ANK 129 158 5.62e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114990
AA Change: S490P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110641
Gene: ENSMUSG00000026121
AA Change: S490P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114991
AA Change: S490P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110643
Gene: ENSMUSG00000026121
AA Change: S490P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191642
AA Change: S490P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142284
Gene: ENSMUSG00000026121
AA Change: S490P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191677
AA Change: S490P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141263
Gene: ENSMUSG00000026121
AA Change: S490P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191785
Predicted Effect probably benign
Transcript: ENSMUST00000193382
Predicted Effect probably benign
Transcript: ENSMUST00000194894
SMART Domains Protein: ENSMUSP00000141712
Gene: ENSMUSG00000079610

DomainStartEndE-ValueType
ANK 30 59 5.6e0 SMART
ANK 63 92 7.1e-8 SMART
ANK 96 127 8.2e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195160
Predicted Effect probably damaging
Transcript: ENSMUST00000195620
AA Change: S490P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141527
Gene: ENSMUSG00000026121
AA Change: S490P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208690
Meta Mutation Damage Score 0.386 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: This gene encodes a member of the semaphorin family of proteins that have diverse functions in neuronal development, heart morphogenesis, vascular growth, tumor progression and immune cell regulation. Lack of the encoded protein in some mice causes exencephaly resulting in neonatal lethality. Mice that bypass exencephaly show no obvious behavioral defects but display distinct pigmentation defects. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit exencephaly, neonatal lethality, and abnormal cerebellum morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C T 1: 11,414,590 R8* probably null Het
Acacb A T 5: 114,195,285 H490L probably damaging Het
Ace C A 11: 105,985,106 H417N probably damaging Het
Adamtsl3 A G 7: 82,450,090 N151D possibly damaging Het
Agap1 A G 1: 89,663,730 N114S probably damaging Het
Arap3 A T 18: 37,984,245 V926D probably damaging Het
Arhgap12 A T 18: 6,112,340 I8N probably benign Het
Arhgef17 A T 7: 100,929,504 F746I probably damaging Het
Atp6v0a1 T C 11: 101,038,786 S471P possibly damaging Het
Bdp1 A G 13: 100,060,940 V979A probably benign Het
Ccdc88c C A 12: 100,913,474 R1789L probably damaging Het
Cckar A T 5: 53,699,873 N327K probably benign Het
Cfap65 T C 1: 74,917,175 T1082A probably damaging Het
Clcn7 T A 17: 25,159,698 I719N probably damaging Het
Col27a1 C G 4: 63,328,631 probably benign Het
Cspp1 C T 1: 10,126,438 T179I probably damaging Het
Dnah1 C T 14: 31,302,292 probably benign Het
Dnah6 A G 6: 73,155,296 V1141A probably benign Het
Dusp4 A G 8: 34,818,479 Y298C probably damaging Het
Efhc1 C A 1: 20,967,401 Y267* probably null Het
Eif2s1 T A 12: 78,866,521 probably null Het
Epo A G 5: 137,483,155 V169A possibly damaging Het
Esr1 A T 10: 5,001,380 Y586F probably benign Het
Fat2 T C 11: 55,287,783 T1484A possibly damaging Het
Fat2 T C 11: 55,296,181 T1280A possibly damaging Het
Gm5828 T C 1: 16,769,261 noncoding transcript Het
Idh3b T C 2: 130,281,510 I187V possibly damaging Het
Kif13a A C 13: 46,793,922 V862G probably benign Het
Kndc1 A G 7: 139,930,756 D1327G probably damaging Het
Mfsd9 T A 1: 40,773,798 R452S probably benign Het
Myh15 C T 16: 49,132,203 R879C probably benign Het
Naip2 T C 13: 100,182,929 R260G possibly damaging Het
Npat T G 9: 53,570,172 L1060R probably damaging Het
Olfr1211 A T 2: 88,929,387 D309E probably benign Het
Olfr1261 A T 2: 89,993,953 T187S possibly damaging Het
Olfr169 T A 16: 19,566,406 H159L probably benign Het
Olfr523 T C 7: 140,176,648 V176A probably benign Het
Olfr667 A C 7: 104,916,808 F163V probably benign Het
Pld5 T C 1: 175,975,626 T296A possibly damaging Het
Polq C T 16: 37,060,264 A651V probably damaging Het
Polr3a G A 14: 24,470,624 P607S probably damaging Het
Ranbp9 G A 13: 43,412,539 R424C probably damaging Het
Rsl1 G A 13: 67,177,165 probably benign Het
Setd3 A T 12: 108,113,344 L300Q possibly damaging Het
Slc15a3 T C 19: 10,857,231 I492T possibly damaging Het
Stag1 T C 9: 100,880,900 probably benign Het
Tgm4 A G 9: 123,051,416 Y294C probably damaging Het
Tm9sf1 A G 14: 55,641,300 S212P probably benign Het
Tmcc1 A G 6: 116,133,865 S156P probably damaging Het
Vmn1r184 A C 7: 26,267,245 M139L probably benign Het
Vmn1r209 A C 13: 22,806,482 F13V possibly damaging Het
Xkr5 T C 8: 18,934,125 E467G probably benign Het
Zdbf2 C T 1: 63,308,972 S2170L possibly damaging Het
Zfp277 G T 12: 40,329,610 probably null Het
Zfp62 T C 11: 49,215,769 I229T probably damaging Het
Zfp810 A G 9: 22,279,028 S195P possibly damaging Het
Zfp94 G A 7: 24,311,502 probably benign Het
Other mutations in Sema4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Sema4c APN 1 36553920 critical splice donor site probably benign 0.00
IGL01824:Sema4c APN 1 36553029 missense possibly damaging 0.76
IGL02236:Sema4c APN 1 36553085 missense probably damaging 1.00
IGL02262:Sema4c APN 1 36550341 missense probably damaging 1.00
IGL02282:Sema4c APN 1 36550203 unclassified probably null
IGL02476:Sema4c APN 1 36555950 missense probably damaging 0.98
IGL02900:Sema4c APN 1 36550745 nonsense probably null
swirl UTSW 1 36550311 missense probably damaging 1.00
IGL02837:Sema4c UTSW 1 36552884 missense probably damaging 1.00
R0427:Sema4c UTSW 1 36553811 nonsense probably null
R0497:Sema4c UTSW 1 36549608 missense probably benign 0.04
R1066:Sema4c UTSW 1 36550200 missense possibly damaging 0.95
R1099:Sema4c UTSW 1 36552110 missense probably damaging 1.00
R1146:Sema4c UTSW 1 36550565 missense probably benign 0.04
R1146:Sema4c UTSW 1 36550565 missense probably benign 0.04
R1639:Sema4c UTSW 1 36553534 missense probably benign 0.00
R3176:Sema4c UTSW 1 36549879 missense possibly damaging 0.65
R3177:Sema4c UTSW 1 36549879 missense possibly damaging 0.65
R3276:Sema4c UTSW 1 36549879 missense possibly damaging 0.65
R3277:Sema4c UTSW 1 36549879 missense possibly damaging 0.65
R3551:Sema4c UTSW 1 36553723 missense probably benign 0.02
R4452:Sema4c UTSW 1 36553756 missense probably benign 0.31
R4883:Sema4c UTSW 1 36552016 missense probably damaging 0.98
R4895:Sema4c UTSW 1 36553570 splice site probably null
R4913:Sema4c UTSW 1 36550185 missense probably benign 0.11
R4944:Sema4c UTSW 1 36550311 missense probably damaging 1.00
R5062:Sema4c UTSW 1 36552978 critical splice donor site probably null
R5077:Sema4c UTSW 1 36551731 missense probably benign 0.20
R5109:Sema4c UTSW 1 36552300 frame shift probably null
R5208:Sema4c UTSW 1 36550326 missense probably damaging 1.00
R5551:Sema4c UTSW 1 36552317 missense probably damaging 1.00
R5912:Sema4c UTSW 1 36554388 missense possibly damaging 0.83
R6578:Sema4c UTSW 1 36550753 missense probably benign 0.02
R7111:Sema4c UTSW 1 36553079 missense possibly damaging 0.48
R7141:Sema4c UTSW 1 36553020 missense probably damaging 0.99
R7252:Sema4c UTSW 1 36550015 missense probably damaging 1.00
X0019:Sema4c UTSW 1 36552996 missense probably damaging 1.00
X0028:Sema4c UTSW 1 36549966 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GAAGTGGCATCAGAGATCCAACTCC -3'
(R):5'- AAACTGAGTTTCCTGGCCCGAGTG -3'

Sequencing Primer
(F):5'- GAGATCCAACTCCAATCACCTTAG -3'
(R):5'- GTCCCTGTCTAAGAAGGTCATGTC -3'
Posted On2014-04-24