Incidental Mutation 'R1644:Clcn7'
ID 173782
Institutional Source Beutler Lab
Gene Symbol Clcn7
Ensembl Gene ENSMUSG00000036636
Gene Name chloride channel, voltage-sensitive 7
Synonyms ClC-7
MMRRC Submission 039680-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1644 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 25352365-25381078 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 25378672 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 719 (I719N)
Ref Sequence ENSEMBL: ENSMUSP00000035964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040729] [ENSMUST00000073277] [ENSMUST00000160961] [ENSMUST00000182292] [ENSMUST00000182621] [ENSMUST00000183178]
AlphaFold O70496
Predicted Effect probably damaging
Transcript: ENSMUST00000040729
AA Change: I719N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035964
Gene: ENSMUSG00000036636
AA Change: I719N

DomainStartEndE-ValueType
low complexity region 60 74 N/A INTRINSIC
Pfam:Voltage_CLC 183 594 1.5e-96 PFAM
CBS 632 687 8.38e-4 SMART
CBS 742 790 1.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073277
SMART Domains Protein: ENSMUSP00000073002
Gene: ENSMUSG00000059562

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 48 578 1.4e-263 PFAM
low complexity region 631 642 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159426
Predicted Effect probably damaging
Transcript: ENSMUST00000160961
AA Change: I699N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124194
Gene: ENSMUSG00000036636
AA Change: I699N

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 40 54 N/A INTRINSIC
Pfam:Voltage_CLC 163 574 1.5e-93 PFAM
CBS 612 667 8.38e-4 SMART
CBS 722 770 1.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162862
SMART Domains Protein: ENSMUSP00000124527
Gene: ENSMUSG00000036636

DomainStartEndE-ValueType
Pfam:Voltage_CLC 5 307 1.3e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182292
SMART Domains Protein: ENSMUSP00000138191
Gene: ENSMUSG00000059562

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 47 571 1.3e-250 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182621
SMART Domains Protein: ENSMUSP00000138090
Gene: ENSMUSG00000059562

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 47 573 2.9e-252 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183178
SMART Domains Protein: ENSMUSP00000138659
Gene: ENSMUSG00000059562

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Meta Mutation Damage Score 0.4499 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the CLC chloride channel family of proteins. Chloride channels play important roles in the plasma membrane and in intracellular organelles. This gene encodes chloride channel 7. Defects in this gene are the cause of osteopetrosis autosomal recessive type 4 (OPTB4), also called infantile malignant osteopetrosis type 2 as well as the cause of autosomal dominant osteopetrosis type 2 (OPTA2), also called autosomal dominant Albers-Schonberg disease or marble disease autosoml dominant. Osteopetrosis is a rare genetic disease characterized by abnormally dense bone, due to defective resorption of immature bone. OPTA2 is the most common form of osteopetrosis, occurring in adolescence or adulthood. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, abnormal bone formation, including osteopetrosis, and retinal degeneration. Mice homozygous for a conditional allele exhibit lysosomal defects with neuronal degeneration and accumulationof giant lysosomes in renal tubule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C T 1: 11,484,814 (GRCm39) R8* probably null Het
Acacb A T 5: 114,333,346 (GRCm39) H490L probably damaging Het
Ace C A 11: 105,875,932 (GRCm39) H417N probably damaging Het
Adamtsl3 A G 7: 82,099,298 (GRCm39) N151D possibly damaging Het
Agap1 A G 1: 89,591,452 (GRCm39) N114S probably damaging Het
Arap3 A T 18: 38,117,298 (GRCm39) V926D probably damaging Het
Arhgap12 A T 18: 6,112,340 (GRCm39) I8N probably benign Het
Arhgef17 A T 7: 100,578,711 (GRCm39) F746I probably damaging Het
Atp6v0a1 T C 11: 100,929,612 (GRCm39) S471P possibly damaging Het
Bdp1 A G 13: 100,197,448 (GRCm39) V979A probably benign Het
Ccdc88c C A 12: 100,879,733 (GRCm39) R1789L probably damaging Het
Cckar A T 5: 53,857,215 (GRCm39) N327K probably benign Het
Cfap65 T C 1: 74,956,334 (GRCm39) T1082A probably damaging Het
Col27a1 C G 4: 63,246,868 (GRCm39) probably benign Het
Cspp1 C T 1: 10,196,663 (GRCm39) T179I probably damaging Het
Dnah1 C T 14: 31,024,249 (GRCm39) probably benign Het
Dnah6 A G 6: 73,132,279 (GRCm39) V1141A probably benign Het
Dusp4 A G 8: 35,285,633 (GRCm39) Y298C probably damaging Het
Efhc1 C A 1: 21,037,625 (GRCm39) Y267* probably null Het
Eif2s1 T A 12: 78,913,295 (GRCm39) probably null Het
Epo A G 5: 137,481,417 (GRCm39) V169A possibly damaging Het
Esr1 A T 10: 4,951,380 (GRCm39) Y586F probably benign Het
Fat2 T C 11: 55,178,609 (GRCm39) T1484A possibly damaging Het
Fat2 T C 11: 55,187,007 (GRCm39) T1280A possibly damaging Het
Gm5828 T C 1: 16,839,485 (GRCm39) noncoding transcript Het
Idh3b T C 2: 130,123,430 (GRCm39) I187V possibly damaging Het
Kif13a A C 13: 46,947,398 (GRCm39) V862G probably benign Het
Kndc1 A G 7: 139,510,669 (GRCm39) D1327G probably damaging Het
Mfsd9 T A 1: 40,812,958 (GRCm39) R452S probably benign Het
Myh15 C T 16: 48,952,566 (GRCm39) R879C probably benign Het
Naip2 T C 13: 100,319,437 (GRCm39) R260G possibly damaging Het
Npat T G 9: 53,481,472 (GRCm39) L1060R probably damaging Het
Or2aj4 T A 16: 19,385,156 (GRCm39) H159L probably benign Het
Or4c126 A T 2: 89,824,297 (GRCm39) T187S possibly damaging Het
Or4c15 A T 2: 88,759,731 (GRCm39) D309E probably benign Het
Or52n2b A C 7: 104,566,015 (GRCm39) F163V probably benign Het
Or6f2 T C 7: 139,756,561 (GRCm39) V176A probably benign Het
Pld5 T C 1: 175,803,192 (GRCm39) T296A possibly damaging Het
Polq C T 16: 36,880,626 (GRCm39) A651V probably damaging Het
Polr3a G A 14: 24,520,692 (GRCm39) P607S probably damaging Het
Ranbp9 G A 13: 43,566,015 (GRCm39) R424C probably damaging Het
Rsl1 G A 13: 67,325,229 (GRCm39) probably benign Het
Sema4c A G 1: 36,589,885 (GRCm39) S490P probably damaging Het
Setd3 A T 12: 108,079,603 (GRCm39) L300Q possibly damaging Het
Slc15a3 T C 19: 10,834,595 (GRCm39) I492T possibly damaging Het
Stag1 T C 9: 100,762,953 (GRCm39) probably benign Het
Tgm4 A G 9: 122,880,481 (GRCm39) Y294C probably damaging Het
Tm9sf1 A G 14: 55,878,757 (GRCm39) S212P probably benign Het
Tmcc1 A G 6: 116,110,826 (GRCm39) S156P probably damaging Het
Vmn1r184 A C 7: 25,966,670 (GRCm39) M139L probably benign Het
Vmn1r209 A C 13: 22,990,652 (GRCm39) F13V possibly damaging Het
Xkr5 T C 8: 18,984,141 (GRCm39) E467G probably benign Het
Zdbf2 C T 1: 63,348,131 (GRCm39) S2170L possibly damaging Het
Zfp277 G T 12: 40,379,609 (GRCm39) probably null Het
Zfp62 T C 11: 49,106,596 (GRCm39) I229T probably damaging Het
Zfp810 A G 9: 22,190,324 (GRCm39) S195P possibly damaging Het
Zfp94 G A 7: 24,010,927 (GRCm39) probably benign Het
Other mutations in Clcn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Clcn7 APN 17 25,370,097 (GRCm39) missense probably damaging 1.00
IGL01735:Clcn7 APN 17 25,370,090 (GRCm39) missense probably benign 0.13
IGL01912:Clcn7 APN 17 25,371,983 (GRCm39) splice site probably benign
IGL01936:Clcn7 APN 17 25,374,350 (GRCm39) missense probably benign 0.44
IGL02084:Clcn7 APN 17 25,376,899 (GRCm39) missense probably benign
IGL02121:Clcn7 APN 17 25,372,058 (GRCm39) missense possibly damaging 0.95
IGL02160:Clcn7 APN 17 25,368,004 (GRCm39) unclassified probably benign
IGL02335:Clcn7 APN 17 25,365,821 (GRCm39) missense probably benign 0.00
IGL02507:Clcn7 APN 17 25,363,443 (GRCm39) missense probably damaging 1.00
IGL02605:Clcn7 APN 17 25,365,792 (GRCm39) missense possibly damaging 0.60
IGL03160:Clcn7 APN 17 25,365,427 (GRCm39) unclassified probably benign
IGL03192:Clcn7 APN 17 25,352,575 (GRCm39) missense probably benign 0.00
IGL03194:Clcn7 APN 17 25,369,522 (GRCm39) missense probably damaging 0.98
IGL03409:Clcn7 APN 17 25,374,359 (GRCm39) missense probably damaging 1.00
R0140:Clcn7 UTSW 17 25,372,728 (GRCm39) missense probably damaging 1.00
R0153:Clcn7 UTSW 17 25,368,176 (GRCm39) unclassified probably benign
R0970:Clcn7 UTSW 17 25,370,208 (GRCm39) critical splice donor site probably null
R1856:Clcn7 UTSW 17 25,379,445 (GRCm39) missense probably damaging 1.00
R2145:Clcn7 UTSW 17 25,363,425 (GRCm39) missense probably benign
R2173:Clcn7 UTSW 17 25,364,583 (GRCm39) missense probably benign
R2401:Clcn7 UTSW 17 25,372,114 (GRCm39) missense probably benign 0.02
R2511:Clcn7 UTSW 17 25,374,420 (GRCm39) missense probably damaging 1.00
R3683:Clcn7 UTSW 17 25,369,567 (GRCm39) missense possibly damaging 0.84
R3684:Clcn7 UTSW 17 25,369,567 (GRCm39) missense possibly damaging 0.84
R3694:Clcn7 UTSW 17 25,378,681 (GRCm39) missense probably damaging 0.99
R4424:Clcn7 UTSW 17 25,379,150 (GRCm39) missense probably damaging 1.00
R4681:Clcn7 UTSW 17 25,376,935 (GRCm39) missense probably damaging 1.00
R4870:Clcn7 UTSW 17 25,372,539 (GRCm39) intron probably benign
R5372:Clcn7 UTSW 17 25,376,153 (GRCm39) missense possibly damaging 0.82
R5820:Clcn7 UTSW 17 25,368,026 (GRCm39) missense probably damaging 1.00
R6154:Clcn7 UTSW 17 25,376,928 (GRCm39) missense probably damaging 0.98
R6181:Clcn7 UTSW 17 25,370,702 (GRCm39) missense possibly damaging 0.79
R6306:Clcn7 UTSW 17 25,376,502 (GRCm39) missense probably benign 0.01
R6798:Clcn7 UTSW 17 25,378,734 (GRCm39) missense probably damaging 1.00
R6961:Clcn7 UTSW 17 25,376,188 (GRCm39) missense probably damaging 1.00
R7020:Clcn7 UTSW 17 25,365,325 (GRCm39) missense possibly damaging 0.76
R7089:Clcn7 UTSW 17 25,372,667 (GRCm39) missense
R7757:Clcn7 UTSW 17 25,375,796 (GRCm39) missense probably damaging 1.00
R8057:Clcn7 UTSW 17 25,368,233 (GRCm39) nonsense probably null
R8670:Clcn7 UTSW 17 25,378,588 (GRCm39) missense probably damaging 0.99
R9031:Clcn7 UTSW 17 25,376,497 (GRCm39) missense probably damaging 0.96
R9720:Clcn7 UTSW 17 25,374,471 (GRCm39) missense probably damaging 1.00
X0020:Clcn7 UTSW 17 25,369,200 (GRCm39) missense probably damaging 1.00
Z1177:Clcn7 UTSW 17 25,371,989 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGCCAAAGTTTCCCACTGCAATC -3'
(R):5'- TGCCTGGCAGCAATTACTCCAC -3'

Sequencing Primer
(F):5'- CGTTCTCTTGAAGCATAAGGTACAC -3'
(R):5'- AGATTCCAGAGGCTCCTTACC -3'
Posted On 2014-04-24