Incidental Mutation 'R1646:Slamf9'
ID173856
Institutional Source Beutler Lab
Gene Symbol Slamf9
Ensembl Gene ENSMUSG00000026548
Gene NameSLAM family member 9
SynonymsCD84-H1, SF2001, 2310026I04Rik, CD2F-10, Cd2f10
MMRRC Submission 039682-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1646 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location172475358-172478575 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 172477340 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 174 (T174A)
Ref Sequence ENSEMBL: ENSMUSP00000027830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027830] [ENSMUST00000052629] [ENSMUST00000111235] [ENSMUST00000127052] [ENSMUST00000127482] [ENSMUST00000135267]
Predicted Effect probably benign
Transcript: ENSMUST00000027830
AA Change: T174A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027830
Gene: ENSMUSG00000026548
AA Change: T174A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 25 128 2.68e-4 SMART
Blast:IG_like 139 198 7e-8 BLAST
low complexity region 199 216 N/A INTRINSIC
transmembrane domain 231 253 N/A INTRINSIC
low complexity region 263 279 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052629
SMART Domains Protein: ENSMUSP00000058275
Gene: ENSMUSG00000037995

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 131 6.81e-6 SMART
IGc2 149 213 4.92e-12 SMART
IG 233 320 8.64e-8 SMART
IG_like 329 412 4.3e1 SMART
IGc2 431 493 9.12e-7 SMART
FN3 508 593 1.82e-4 SMART
FN3 624 705 7.01e-6 SMART
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
low complexity region 909 930 N/A INTRINSIC
low complexity region 942 953 N/A INTRINSIC
low complexity region 1143 1165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111235
SMART Domains Protein: ENSMUSP00000106866
Gene: ENSMUSG00000037995

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 131 6.81e-6 SMART
IGc2 149 213 4.92e-12 SMART
IG 233 320 8.64e-8 SMART
IG_like 329 412 4.3e1 SMART
IGc2 431 493 9.12e-7 SMART
FN3 508 593 1.82e-4 SMART
FN3 624 705 7.01e-6 SMART
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
low complexity region 909 930 N/A INTRINSIC
low complexity region 942 953 N/A INTRINSIC
low complexity region 1143 1165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127052
SMART Domains Protein: ENSMUSP00000123401
Gene: ENSMUSG00000037995

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Blast:IG 26 109 6e-55 BLAST
SCOP:d1biha2 28 108 6e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127482
SMART Domains Protein: ENSMUSP00000117854
Gene: ENSMUSG00000037995

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 131 6.81e-6 SMART
IGc2 149 213 4.92e-12 SMART
IG 233 320 8.64e-8 SMART
IG_like 329 412 4.3e1 SMART
IGc2 431 493 9.12e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132141
Predicted Effect probably benign
Transcript: ENSMUST00000135267
SMART Domains Protein: ENSMUSP00000116948
Gene: ENSMUSG00000037995

DomainStartEndE-ValueType
IG_like 4 68 3.29e1 SMART
IGc2 86 148 3.03e-12 SMART
low complexity region 156 168 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194187
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signaling lymphocytic activation molecule family. The encoded protein is a cell surface molecule that consists of two extracellular immunoglobulin domains, a transmembrane domain and a short cytoplasmic tail that lacks the signal transduction motifs found in other family members. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,462,990 S751T probably damaging Het
Akna T G 4: 63,383,892 I581L probably benign Het
Cacnb4 A G 2: 52,474,900 I117T possibly damaging Het
Capn1 A T 19: 5,997,730 F434L probably benign Het
Cbs T C 17: 31,613,195 T547A probably benign Het
Col6a5 A T 9: 105,862,749 L2557* probably null Het
D17Wsu92e A G 17: 27,793,960 S88P probably damaging Het
D1Ertd622e A T 1: 97,645,806 I178N probably damaging Het
Dach1 A G 14: 98,169,114 S66P unknown Het
Ddx31 T C 2: 28,892,520 V625A probably benign Het
Dmxl1 T G 18: 49,962,261 V2969G probably damaging Het
Eapp T A 12: 54,685,960 K122* probably null Het
Epb41l5 G T 1: 119,550,022 probably benign Het
Fat1 T C 8: 45,018,042 S1628P probably damaging Het
Fgfr2 T A 7: 130,242,644 E37V probably damaging Het
Fgfr4 A T 13: 55,165,964 N529Y probably damaging Het
Fsip2 A T 2: 82,978,517 T1727S probably benign Het
Gak A T 5: 108,602,854 S397T probably damaging Het
Gm6040 T A 8: 20,917,097 I36F possibly damaging Het
Grhl1 A G 12: 24,611,861 D513G possibly damaging Het
Gstt1 T A 10: 75,784,106 D219V possibly damaging Het
Hcfc2 T G 10: 82,701,027 V91G probably damaging Het
Hells A T 19: 38,967,783 I808L probably benign Het
Icmt T A 4: 152,299,715 V110E possibly damaging Het
Iqca C T 1: 90,140,038 V164M probably damaging Het
Klri1 G A 6: 129,703,336 P119S probably benign Het
Krt71 C A 15: 101,738,764 probably null Het
Lpin1 A G 12: 16,573,658 probably null Het
Metap2 T C 10: 93,870,197 H241R probably damaging Het
Myh15 A G 16: 49,195,568 Y1869C probably damaging Het
Myo1h G A 5: 114,317,632 G59E possibly damaging Het
Ncam2 T G 16: 81,465,706 probably benign Het
Npat T C 9: 53,555,134 V241A probably benign Het
Npbwr1 C A 1: 5,917,254 V14L probably benign Het
Nup37 T A 10: 88,178,234 V323E possibly damaging Het
Olfr1036 A G 2: 86,075,616 N292S probably damaging Het
Olfr1351 C A 10: 79,017,506 Y61* probably null Het
Olfr483 C T 7: 108,103,591 T94I probably benign Het
Olfr743 A T 14: 50,533,583 Q57L probably benign Het
Pdlim4 A T 11: 54,056,254 L132Q possibly damaging Het
Ptcd3 T C 6: 71,898,395 D201G probably benign Het
Ptk7 A T 17: 46,586,297 F370I probably benign Het
Pus7l T C 15: 94,533,636 N371D probably benign Het
Pzp G A 6: 128,503,555 A589V probably benign Het
Rasef T A 4: 73,734,549 R572W probably damaging Het
Reep5 T C 18: 34,349,659 T166A probably benign Het
Rhov A G 2: 119,271,020 V35A probably damaging Het
Ripk4 C T 16: 97,743,897 G517R probably damaging Het
Rnasel A G 1: 153,755,054 T439A probably damaging Het
Slc12a9 A G 5: 137,323,149 L414P probably damaging Het
Slf1 G A 13: 77,066,648 R640* probably null Het
Slfn8 G T 11: 83,016,886 P277Q probably damaging Het
Stpg2 T A 3: 139,419,702 probably benign Het
Tm9sf3 A C 19: 41,223,179 N408K possibly damaging Het
Trio A G 15: 27,758,347 V2049A possibly damaging Het
Ttn A T 2: 76,814,733 I11180N probably damaging Het
Ush2a T C 1: 188,415,821 C982R probably damaging Het
Usp36 C T 11: 118,273,566 V207M probably damaging Het
Uvrag T C 7: 99,118,224 T67A probably damaging Het
Vasp G A 7: 19,260,978 probably benign Het
Vmn2r115 T C 17: 23,359,539 F662S probably damaging Het
Vmn2r54 A T 7: 12,632,507 C167S probably damaging Het
Vmn2r71 C A 7: 85,621,268 N547K probably damaging Het
Wasf2 A G 4: 133,176,591 I37V probably benign Het
Wwc2 T C 8: 47,842,902 E1111G unknown Het
Zfp317 A G 9: 19,647,312 Y274C probably damaging Het
Zhx3 T C 2: 160,781,275 Y324C probably damaging Het
Zzef1 T C 11: 72,864,036 probably null Het
Other mutations in Slamf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0020:Slamf9 UTSW 1 172475515 missense possibly damaging 0.84
R1220:Slamf9 UTSW 1 172477331 missense probably benign 0.20
R2321:Slamf9 UTSW 1 172477413 missense probably damaging 1.00
R4124:Slamf9 UTSW 1 172476241 missense probably damaging 1.00
R4826:Slamf9 UTSW 1 172476441 missense probably benign 0.01
R4831:Slamf9 UTSW 1 172477264 nonsense probably null
R5010:Slamf9 UTSW 1 172476213 missense possibly damaging 0.80
R5223:Slamf9 UTSW 1 172476232 missense possibly damaging 0.89
R5864:Slamf9 UTSW 1 172476466 missense probably benign 0.25
R7480:Slamf9 UTSW 1 172477473 missense probably damaging 1.00
X0054:Slamf9 UTSW 1 172478101 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACAGCTCTCGAAGCCTTTATTCCC -3'
(R):5'- TTGCACAGGCTCAGGAATGGTG -3'

Sequencing Primer
(F):5'- TGTCTCAGCAGATCCTCAGG -3'
(R):5'- CAGGAATGGTGTCTTGGGC -3'
Posted On2014-04-24